Dept. of Food Hygiene,

Fac. of Vet. Med. Beni-Suef Cairo University, Egypt.

Measuring the capability of Immunomagnetic Separation-PCR (IMS-PCR) for the detection of one CFU

of Escherichia coli O:157 H:7 in milk

and soft cheese

(With 4 Tables and One Figure)

By

Mona H. Tolba and G.M. Hassan

(Received at 1/12/2004)

قياس قدرة الفصل المناعي المغناطيسي – سلسله تفاعل إنريم البلمره للکشف عن مستعمره واحده من ميکروب الإيشيريشيا کولاي  0157 H:7 في اللبن والجبن الطرى

منى هاشم طلبه , جمال محمد حسن

اجريت هذه الدراسة لعزل ميکروب الاشريشياکولاى والذي ينتمي إلىO:157 H:7 من اللبن الخام والجبن الأبيض الطرى وقياس مدى قدرة وحساسية طريقة ال IMS-PCRعلى عزل هذا الميکروب منها حيث تم تجميع 100 عينة (50عينة جبن ابيض طازج و50عينة لبن خام) من مناطق مختلفة من محافظة بنىسويف وتم عزل الميکروب من عينة واحدة فقط من اللبن الخام وعينتان من الجبن وتم حقن الميکروب المعزول فى عينات من اللبن والجبن الابيض الطرى بأعداد مختلفة وقياس مدى قدرة وحساسية طريقة ال IMS-PCR على عزل هذا الميکروب.

Summary

This study was conducted to determine the presence of Escherichia coli O:157 H:7  in raw milk and soft cheese and determination the ability and sensitivity of IMS-PCR method for detection one CFU of this micro-organism in the same products. A total of 100 samples of raw milk and fresh soft cheese (5o samples of each) were randomly collected from different localities in Bani-suef province and examined according to (Hitchins et al., 2001). Escherichia coli O:157 H:7 was isolated from 1(2.0%) and 2(4.0%) of the examined raw milk and soft cheese samples, respectively. Milk and soft cheese samples were spiked with E.coli O157 at low levels. The samples were enriched in LB broth and incubated at 37°C. Aliquots of the enriched culture were analyzed either by PCR and IMS-PCR. This study showed that as few as one organism can be detected in 25 ml milk by IMS-PCR method. After 6 h of incubation IMS-PCR were able to detect E.coli from milk but not from cheese samples. After 8 hours of incubation PCR alone was not able to detect any of the samples tested, but IMS combined with PCR was able to detect E.coli in  milk and cheeses at low inoculum level. The results indicated that the ability of the IMS to remove inhibiting factors from various food samples is different.

Key words: PCR, E.coli O157: H7, milk, soft cheese

Introduction

Raw milk has been described as a source of infections caused by shiga toxin-producing Escherichia coli serotype O157:H7 (Keene et al. 1997). The ability of E. coli to survive in fermented dairy products made from raw milk (Abdul-Raouf et. al., 1996; McIngvale et. al., 2000; Maher et al., 2001) is of major concern because the consumption of such products has also led to infection in human.

Cultural methods for E. coli detection involve a non-selective pre-enrichment, followed by selective enrichment and plating on selective agars. Suspected colonies are confirmed biochemical and serologically; the complete test requires three to four days to obtain a negative result and 5-7 days to get confirmed positive result. A number of rapid methods for the detection of E. coli in foods have been developed, including electrical techniques, immunoassays, and nucleic acid probe (Meng et. al., 1996). These assays utilize primers and probes that hybridize specifically to complementary sequences found in the verotoxigenic E. coli (VTEC) type including E. coli O157:H7.  But in food analysis, rapid methods still lack sufficient sensitivity and specificity for direct testing; hence, food still in need to be culture-enriched before analysis (Feng, 1997). Although enrichment is a limitation in terms of assay speed, it provide essential benefits, such as diluting the effect of inhibitors, allowing the differentiation of viable from non-viable cells and allowing the repair of cell stress or injury that may be resulted during food processing.

The ability of PCR to amplify specific DNA reduces the need for the large quantities of test DNA required for the hybridization assays. In theory one copy of the target gene is sufficient for successful amplification. In many ways, the extreme sensitivity of PCR can be compared with cultivation of bacteria on nonselective media, when a single live bacterium can be detected up on initiation of the colony (Olsvik et. al. 1994). However, certain disadvantages limit the technique. The sample volume traditionally used in PCR ranges from <1 to 20ml for several microbiological applications, such testing for Salmonella spp. In foods, requirements are often one cultivable organism per 100 g/ml of sample. Reduction of the sample to 1 to 20ml restrict the test sensitivity to a theoretical minimum of 5000 to 100,000 organism per ml (Olsvik and Stockbine 1993). An additional factor hindering the use of PCR directly from samples is the sensitivity of the Taq polymerase to inhibitor elements in food samples, thereby requiring extensive sample preparation to remove, dilute or inactivate inhibitors prior to PCR amplification (Fratamico et. al., 2000).

Use of Immunomagnetic Separation (IMS) as a pre-PCR step appears to solve these problems. The bacteria in the sample are concentrated to a suitable volume of 1-100 ml, and specific Taq polymerase inhibitors are simultaneously removed. Adding the magnetic bead fraction to a growth medium for pre-cultivation can increase the number of target organisms for the PCR. Samples that have been frozen often contain nonviable cells, but these cells can still be extracted with IMS and identified by PCR. This method can also be of importance in identifying the origin of strains involved in food-borne outbreaks if only nonviable bacteria remain in the implicated food samples.

The potential low infective dose of E.coli necessitates the ability to detect low numbers in food. Therefore the goal of this study is to investigate the capability of IMS-PCR for detection of one CFU in milk and soft cheese.

Materials and methods

One hundred  random samples of milk and fresh soft cheese samples (50 of each) were collected from different localities in Bani-suef province, Egypt. All samples were examined for the presence of Escherichia coli O:157 H:7. according to(Hitchins et al., 2001).

The obtained Escherichia coli O:157 H:7 strain was inoculated onto Luria-Bertani (LB) agar plates (Difco laboratories, Detroit, Mich.) and incubating the plates overnight at 37°C. LB broth inoculated with cells from overnight LB agar plate and incubated overnight with shacking at 37°C was used in the spiking experiment.

Inoculation of the samples

 Milk and soft cheese samples (25 ml or gm) were inoculated with different concentration of LB broth containing 10⁴, 10³, 10²,10, 1 and 0 CFU of E. coli O157. The cell concentration was determined by the standard plate technique. Duplicate samples were inoculated with each dilution of E. coli strain and two uninoculated samples of milk were included as negative controls with each series of dilutions. Samples in 225 ml LB broth were mixed and homogenized in a stomacher and incubated at 37°C. Samples were taken at regular intervals 0, 2,4,6,8,10, 12, 24 hours. Aliquots were taken for treatment by IMS and PCR.

Immunomagnetic Separation

IMS was performed on a 1-ml of enriched cultures and 20ml of magnetic beads coated with an antibodies prepared to the lippolysaccharided of E. coli O157 (Dyna-beads anti-E.coli O157, Dynal INC., Lake Success, NY) was added in a 1.5 ml microcentrifuge tube. The beads suspended, mixed, incubated at room temperature and rotated for 30 rpm for 30 min on an Orbitron Rotator II (Fisher Scientific, Mississauga, ON). Samples were placed in a magnetic particle concentrator (MPC 10, Dynal) for three minutes and washed twice in lambda buffer (2.5 gm Mg So4.7H2O, 0.006 g gelatin, 6ml 0.1 M tris buffer, pH. 7.2, in 11ml distilled water) (Chapman et.al. 2001 and Favrin et. al., 2003). After the final wash a final volume of 100 ml was obtained

Efficiency of IMS

Just after the dilutions were prepared (without enrichment), the efficiency of magnetic capture was tested with each dilution. To determine the cell numbers in dilutions, duplicate plate counts were obtained. After magnetic capture, the beads were resuspended in 1 ml of lambda buffer, and duplicate plate counts were counted, and the values were compared with the numbers of CFU per milliliters in the original dilutions.

PCR

A PCR assay was used to amplify a 259 bp amplimer specific for E.coli O157. PCR was performed on samples before IMS. Then IMS was performed on 1-ml portion of enrichment culture as described above. After the final wash and separation, the beads were resuspended in 100 ml of sterile nuclease free water (Promega). The bead suspension 25ml was heated to 95°C for 10 min, frozen at -20°C for 30 min, thawed at ambient temperature and centrifuged at 15,000 X g for 10 min. the supernatant (5ml) was used as a DNA template in 50ml P CR reaction. Supernates were stored at - 20°C when not in use.

A 50 ml Consists of 5ml DNA template, 2ml deoxinuleotides (dntps) (Roche), 10ml MgCL₂ 10X PCR buffer (Roche), 50 pmol of forward primer, 50 pmol of reverse primer and 0.5 units of Taq polymerase (Roche). The PCR mix placed in thermal cycler (Gene Amp PCR System 9700, A& B Applied biosystem) and run for an initial denaturation period of 94°C for 4 minutes, followed by 35 cycles of 94 for 1 minutes, 60 for 1 minute and 72 for 1 minutes and a final extension period of 72 for 7 minutes. PCR products were separated by electrophoresis in 1% agarose gel in tris-Borate buffer pH 8.3. 100bp ladder plus was used as a size marker (MBI-Fermetas). Gel was stained with ethedium bromide (10mg/ml) and the DNA was visualized under UV transilluminator by Standard methods (Sambrook et. al., 1989).

Sequences of primers used in this study are

Primer 1: TTTACGATAGACTTCTCGAC

Primer 2: CACATATAAATTATTTCGCTC

Results and discussion

Recently, enterohaemorrhagic E.coli (EHEC 0157: H7) has received considerable attention because of its implication in several outbreaks. It is first recognized as a food pathogen in 1982(Zheo and Doyle 1994, Hudson et al. 1997).It was reported as the third most common pathogen after Salmonella and Campylobacter. The organism affects all ages, requires a low inoculum (50 viable cells/gm) and can cause death.

EHEC produces "O" verotoxins or shiga like toxin that cause damage to the intestinal lining. EHEC infection is associated with outbreaks of haemorrhagic colitis (HC) which occurs most frequently in the developing countries (Keene et al., 1997). The usual illness includes diarrhoea, which often bloody and abdominal cramps, with little or no fever. Illness usually lasted for 6-8 days.

Subsequent development of serious complication such as Haemolytic Uraemic Syndrome (HUS) and microangiopathic haemolytic anaemia. The death rate ranged from 3-8%. HUS occurs more commonly in infants and young children as it is the major cause of renal failure in such age (Allerberger et al., 1997 and Koatkia et al., 1997).

Raw milk is proved to be the vehicle of 2.9%of the over all E. coli O:157 H:7 outbreaks (Doyle et al., 199) with source of contamination is probably faecal material transferred to milk during milking (Padhye and Doyle,1992). Moreover consumption of raw milk and raw milk cheese have been documented as vehicles for several E. coli O:157 H:7 outbreaks (Ryser, 2001).

The results in Table (1) revealed that out of the 100 raw milk and soft cheese samples, E.coli O:157 H:7 could be isolated from 1 (2.0%) and 2 (4.0%) of the examined milk and fresh soft cheese samples, respectively.

Similar results were reported byAbd EL-Hady et al. (1995) and Abd EL-Hady and Moawad (1995).

The high results of E.coli O157:H7 may be due to its ability tosurvive for long time at low temperature than at high temperatureAltieri et al. (1997).

Experiment to estimate the specificity of IMS were carried out with mixture of Enterobacter cloacae / Salmonella. The CFU/ml was measured before and after IMS. Table 2 shows that there was not any non specific reaction with tested strains. One bead can entrap one or more bacterial cells that may be of various genera, if non-specific reaction occurs. Therefore the number of CFU may differ from the number of cells in the tested sample. The efficiency and the sensitivity of IMS in isolating E.coli from cheese was lower than that of milk samples. The colony forming unit was 8.3 X10⁴ CFU as compared to 7.9 X10⁴ CFU for milk and cheese samples respectively. This lower sensitivity may be attributed to the complexity of the cheese matrix (Table, 2).

Both method PCR and IMS-PCR showed equal sensitivity with all samples incubated less than 6 hours, where negative results were obtained at incubation times 0, 2, and 4 hours of incubation. This study showed that as few as one organism can be detected in 25 ml milk by IMS-PCR method. After 6 h of incubation IMS-PCR were able to detect E.coli from milk but not from cheese samples. After 8 hours of incubation PCR alone was not able to detect any of the samples tested, but IMS combined with PCR was able to detect E.coli in both kind of samples tested, milk and cheeses (Table, 3). The detection limit of 1 CFU per 25ml of milk was observed, this limit was lower than the detection limit for soft cheese which is 10- 10² CFU after incubation times 8 and 6 hours respectively. These results indicated that the ability of the IMS to remove inhibiting factors from various food samples is different. So, we attributed this lower sensitivity to the physical entrapment of E.coli cells through the complex matrix of soft cheese.

The IMS and PCR assay combines selective extraction of bacteria by specific antibodies with primer specific PCR amplification, figure 1. PCR was the final step of specific detection. When using different samples, different sensitivities were obtained. Extracts of cheese are known to interfere with detection, as was shown earlier studies by Herman and de Ridder, 1993; Rossen et. al. 1992; and Wernar et. al. 1991.

The results of both methods (PCR and IMS-PCR) were completely in agreement when samples were pre-enriched for 24 hours, (Table, 4). IMS-PCR performed much better than PCR at lower incubation times (6 and 8 hours).  But it should also be noted that in this experiment, only LB broth was used as enrichment broth. The results illustrate the importance of IMS as preparatory step for the sensitive detection of E.coli, as shown previously (Wright et al 1994 and Reinders et al 2002, Fitzmaurice et al 2004). The sensitivity of IMS-PCR was lower than the expected range (1 CFU) in cheese samples, however optimizing enrichment broth may bring the number of positive samples close to the expected result.    

There was no difference in detection limit after 10 hours enrichment for E.coli present regardless of the incubation time, so for the purposes of a rapid enrichment for use with PCR detection it was considered that a 10-h enrichment period in IMS was adequate.

Pre-enrichment of food samples for 8-10 hours was required and an essential step for an IMS-PCR technique to detect E.coli O157 in artificially contaminated dairy product.

It is assumed that E.coli O157 in milk and dairy product (Reinders et. al., 2002) is usually present in very low concentration. To determine the prevalence of this organism in milk or its dairy products, sensitive methods are required. PCR might contribute considerably to the efficiency of the analysis and enable large-scale or routine surveys. PCR-based assays are targeting specific genetic markers rather than depending on cultural and biochemical properties, represent powerful alternative with high sensitivity and specificity for immediate identification of specific microorganisms. However, when applying this technique to food samples, a major challenge is interference resulting from food constituents or microbial metabolites. Although the specific identities and modes of action of inhibitors remain unclear, it is possible that they act by hampering cell lysis, degrading or binding nucleic acids or inhibiting DNA polymerase (Wilson 1997). Inhibitions of PCR reactions result in poor detection sensitivity and even complete reaction failure (false negative results).

Use of IMS as a pre-PCR step appears to solve several of these problems. Therefore we conclude that the IMS-PCR is a rapid, specific and an essential method for the detection of low numbers of E. coli in milk and dairy products.

Table 1: Incidence of E. coli O157: H7 in examined raw milk and fresh soft cheese samples:

Table 2: Specificity of immunomagnetic separation for isolating E.coli O157:H7 in mixed culture 

Table 3: Detection of E. Coli O157 at different incubation time using IMS-PCR

Table 4: Sensitivity of IMS-PCR after enrichment for detecting E.coli O157 using different inoculation levels

Figure 1: PCR profile of E. coli O157 strain 920333 from milk samples.

A: molecular weight standard (100bp ladder plus); B, E, and J: non E.coli samples lanes; C,D,F,G,H,I, K,L,M and N: a band of 259bp (O157 antigen)

REFERENCES

Abd-El-Hady, H.M.; Halawa, M.A. and Saadia, H. EL-Shinawy (1995):  Surveillance of Enterohemorrhagic Escherichia coli (E.coli O157:H7) in milks and Kareish cheese. Assiut V.M.J., 3, (66).

Abd-El-Hady, H.M. and Moawad, A.A. (1995): Using the micro ID for rapid identification of Escherichia coli 0157:H7 in kareish cheese. Alex. Journal of Vet. Scince, 11: 111-113.  

Abdul-Raouf, U.M.; Ammar, M.S. and Beuchat, L.R. (1996): Isolation of  Escherichia coli O157:H7 from some Egyptian foods. International Journal of Food Microbiology. 29: 423-426.

Allerbrger, F.; Solder, B.; Caprioli, A. and Karch, H. (1997): Enterohaemorrhagic Escherichia coli and haemolytic uremic syndrome. Wien-Klin. Wochenschr Sep., 19; 109 (17): 669-677.

Altieri, C.; Corbo, M.R. and Massa, S. (1997): A note on growth and survival of Escherichia coli 0157:H7 in fresh pasteurized milk . Advances in food sciences, 19: 22-24.

Chapman, P.A.; Ellin, M.; Ashton, R. and Shafique, W. (2001): Comparison of culture, PCR and immunoassays for detecting Escherichia coli O157 following enrichment culture and immunomagnetic separation performed on naturally contaminated raw meat products. International Journal of Food Microbiology. 68: 11-20.

Doyle, M.P.; Zhao,  T.; Meng, J. and Zhao, S. (1997): Escherhia coli O157: H7  in Food Microbiology Fundamentals and Frontiers. Doyle, M.P. bluchet, L.R. and Montville, T.J. eds. ASM press Washington, D.C.

Favrin, S.J.; Jassim, A.S. and Griffiths, M.W. (2003): Application of a novel immuomagnetic separation –bacteriophage assay for the detection of Salmonella entriitidis and Escherhia coli O157: H7 in food. Int. J. of Food Microbiol. 85: 63-71.

Feng, P. (1997): Impact of Molecular Biology on the Detection  of Foodborne Pathogens. Mol. Biotech. 7: 267-278.

Fitzmaurice, J.; Duffy, G.; Kilbride, B.; Sheridan, J.J.; Carroll, C. and Maher, M. (2004): Comparison of a membrane surface adhesion recovery method with an IMS method for use in a polymerase chain reaction method to detect Escherichia coli O157:H7 in minced beef. Journal of Microbiol. Met. 59: 243-252.

Fratamico, P.M.; Bagi, L.K. and Pepe, T. (2000): A multiplex polymerase chain reaction assay for rapid detection and identification of Escherichia coli O157: H7 in foiods and bovine feces. J. of Food Protection. 63:103201037.

Herman, L. and de Ridder, H. (1993): Cheese component reduce the sensitivity of detection of Listeria by the Polymerase Chain Reaction. Net. Milk Dairy J. 47: 23-29.

Hitchins, A.D.; Feng, P.; Watkins, W.D.; Rippey, S.R. and Chandler, L.A. (2001): E. coli and the coliform bacteria in Bacteriological Analytical Manual, chapter4.

Hudson, L.M.; Chen, j.; Hill, A.R. and Griffiths, M.W. (1997): Bioluminescence: a rapid indicator of Escherichia coli O157:H7 in selected yoghurt and cheese varities. J. Food Prot., 60: 891-897.

Keene, W.E.; Hedberg, K.; Herriot, D.E. et al. (1997): A prolonged outbreak of Escherichia coli  serotype O157:H7 infections caused by commercially distributed raw milk. Journal of Infectious Diseases. 176: 815-818.

Koatkia, P.; Mylonakis, F. and Flanigan, T. (1997): Enterohaemorrhagic Escherichia coli O157:H7 an emerging pathogen. Am. Fam. Physician sep. 1;56(3): 853-6.859-61.

Maher, M.M., Jordan, K.N.; Upton, M.E. and Coffey, A. ( 2001): Growth and survival of Escherichia coli  O157:H7 during the manufacture and ripening of a smear-ripened cheese produced from raw milk. Journal of Applied Microbiology. 90: 201-207.

McIngvale, S.C.; Chen, X.Q.; McKillip, J.L. and Drake, M.A. (2000): Survival of Escherichia coli O157:H7 in buttermilk as affected by contamination point and storage temperature. Journal of Food Protection. 63: 441-444.

Meng, J.; Zhao, S.; Doule, M.P.; Mitchell, S.E. and Kresovich, S. (1996): Polymerase chain reaction for detecting Escherichia coli O157: H7. Int. J. Food Microbio. 32: 103-113.

Olsvik, Q. and Stockbine N.A. (1993): PCR detection of heat-stable, heat labial and Shiga –like toxin genes in Escherichia coli, p. 271-276. In D.H. Persing, T.F. Smith, F.C.

Olsvik, Q.; Popovic, T.; Skjerve, E. and Kofitsyo, S. et al. (1994): Magnetic Separation Techniques in diagnostic Microbiology. Clinical Microbiology Reveiws. 7: 43-54.

Padhye, N.V. and  Doyle, M.P. (1992): Escherichia coli O157:H7 epidemiology, pathogenesis and methods for detection in food. J. of Food Protection, 55( 555-565).

Reinders, R.D.; Barna, A.; Lipman, L.J.A. and Bijker, P.G.H ( 2002): Comparison of the sensitivity of manual and automated immunomagnetic seperation methods for detection of shiga toxin-producing Escherichia coli O157:H7 in milk. J. of Applied Microbiol. 92: 1015-1020.

Rossen, L.; Norskov, P.; Holmstrom, K. and Rasmussen, O.F. (1992): Inhibition of PCR by components of food samples. Microbial diagnostic assays and DNA extraction solutions. Int. J. Food Microbiol. 17: 37-45.

Sambrook, J.; Fritsch, E.F. and Maniatis, T. (1989): Molecular Cloning: A laboratory Manual. Cold Spring Harbor Laboratory Press, New York, PP. 1.21-1.32.

Ryser, E.T. (2000): Public health concerns. P. 263-404 in Applied dairy Microbiology. E.H. Marth and J.L.Steele, eds. Marcel Dekker, Inc.NY.

Tenover, and White, T.J. (ed.), Diagnostic molecular microbiology, principles and applications. American Society for Microbiology, Wasshington D.C.

Wernars, K.; Heuvelman, C.J.; Charabarty, T. and Notermans, S.H.V. (1991): Use of the polymerase  chain reaction for direct detection of Listeria monocytogenes in soft cheese. J. Appl. Bacteriol. 70:121-126

Wilson, I.G. (1997): Inhibition and facilitation of nucleic acid amplification. Applied and Environmental Microbiology. 63: 374103751.

Wrieght, D.J.; Chapman, P.A. and Siddons, C.A. (1994): Immunomagnetic separation as a sensitive method for isolating Escherichia coli O157 from food samples. Epidemiology and infection. 113: 31-39.

Zheo, T. and Doyle, M.P. (1994): Fate of Enterohaemorrhagic Escherichia coli O157:H7 in commercial mayonnaise. J. Food Prot., 57: 780-783.