CHARACTERIZATION OF E. COLI ASSOCIATED WITH HIGH MORTALITY IN POULTRY FLOCKS

Authors

1 Bacteriology Dept Reference Laboratory for Veterinary Quality Control on Poultry Production, Animal Health Research Institute, Nadi El-Seid St., P.O. Box 246, Dokki, Giza 12618, Egypt.

2 National Laboratory for Veterinary Quality Control on Poultry Production, Animal Health Research Institute, Nadi El-Seid St., P.O. Box 246, Dokki, Giza 12618, Egypt

Abstract

A total of 105 cases of broilers were collected from broiler flocks showing high mortality rates in Sharkia Governorate. E. coli was isolated from 84 (80%) cases. A number of 11 different serotypes were identified, of which O114:K90 was the most detected with 17.9% of the total isolates. While O125:K70, O55:K59, O111:K58 and O26:K60 were identified with the percentages of 14.3%, 14.3%, 10.7% and 10.7%, respectively. Five serotypes (O145:K –, O25:K11, O44:K74, O126:K71, O118:K –) had the same isolation percentage (3.6%). However, serotyping failed to determine 7.1% of the isolates. Studying antibiotic resistance pattern of E.coli isolates revealed that all the isolates demonstrated multidrug resistance pattern. The highest resistance rates were recorded against Doxycyclin (100%), while the resistance against Penicillin, Lincomycin, Nalidixic Acid, Tetracycline and Oxitetracycline was (96.4% each). The highest sensitivity rates were recorded to Colistin (89.3%), Ciprofloxacin (75%) and Gentamycin (50%). 380 bp of the island-associated gene eaeA was amplified by PCR for 14 representative isolates of the different serotypes to estimate their virulence.  Quinolone resistance was detected by amplifying 403 bp of the qepA gene (Plasmid-encoded efflux pump gene), 516 bp, 469 bp, 417 bp and 113 bp of the qnrA, qnrB, qnrS and aac(6′)-Ib-cr genes (Plasmid-mediated quinolone resistance genes). Amoxicillin resistance was detected by amplifying 516 bp of the blaTEM gene which encodes the β-lactamases. It was concluded that multiresistant virulent strains of E. coli are circulating in broiler flocks and are implicated in cases of high mortalities causing great economic losses.

Keywords


CHARACTERIZATION OF E. COLI ASSOCIATED WITH HIGH MORTALITY IN POULTRY FLOCKS

 

SAMAH EID AS. and AHMED M. ERFAN

National Laboratory for Veterinary Quality Control on Poultry Production, Animal Health Research Institute, Nadi El-Seid St., P.O. Box 246, Dokki, Giza 12618, Egypt.

Email: samaheid@ymail.com

 

 

 

ABSTRACT

 

 

 

Received at: 18/8/2013

 

Accepted: 23/10/2013

A total of 105 cases of broilers were collected from broiler flocks showing high mortality rates in Sharkia Governorate. E. coli was isolated from 84 (80%) cases. A number of 11 different serotypes were identified, of which O114:K90 was the most detected with 17.9% of the total isolates. While O125:K70, O55:K59, O111:K58 and O26:K60 were identified with the percentages of 14.3%, 14.3%, 10.7% and 10.7%, respectively. Five serotypes (O145:K –, O25:K11, O44:K74, O126:K71, O118:K –) had the same isolation percentage (3.6%). However, serotyping failed to determine 7.1% of the isolates. Studying antibiotic resistance pattern of E.coli isolates revealed that all the isolates demonstrated multidrug resistance pattern. The highest resistance rates were recorded against Doxycyclin (100%), while the resistance against Penicillin, Lincomycin, Nalidixic Acid, Tetracycline and Oxitetracycline was (96.4% each). The highest sensitivity rates were recorded to Colistin (89.3%), Ciprofloxacin (75%) and Gentamycin (50%). 380 bp of the island-associated gene eaeA was amplified by PCR for 14 representative isolates of the different serotypes to estimate their virulence.  Quinolone resistance was detected by amplifying 403 bp of the qepA gene (Plasmid-encoded efflux pump gene), 516 bp, 469 bp, 417 bp and 113 bp of the qnrA, qnrB, qnrS and aac(6′)-Ib-cr genes (Plasmid-mediated quinolone resistance genes). Amoxicillin resistance was detected by amplifying 516 bp of the blaTEM gene which encodes the β-lactamases. It was concluded that multiresistant virulent strains of E. coli are circulating in broiler flocks and are implicated in cases of high mortalities causing great economic losses.

 

 

Key words:E. coli, Poultry flocks, plasmid-encode, efflux genes.

 

 


INTRODUCTION

 

Most of the human extraintestinal Escherichia coli infections, including those involving antimicrobial resistant strains, are caused by members of a limited number of distinctive E. coli lineages, termed extraintestinal pathogenic E. coli (ExPEC), that has a special ability to cause disease at extraintestinal sites when they exit their usual reservoir in the host's intestinal tract. Multiple lines of evidence suggest that many of the ExPEC strains encountered in humans with urinary tract infection, sepsis, and other extraintestinal infections, especially the most extensively antimicrobial-resistant strains, may have a food animal source and may be transmitted to humans via the food supply (Manges  and Johnson, 2012).

 

Pathologic lesions caused by ExPEC are reported for many farm animals, especially poultry, in which colibacillosis is responsible for huge losses within broiler chickens. As antimicrobials are commonly used for livestock production, infections due to antimicrobial-resistant ExPEC transferred from animals to humans could be even more difficult to treat. These findings, combined with the economic impact of ExPEC in the animal production industry demonstrate the need for adapted measures to limit the prevalence of ExPEC in animal reservoirs while reducing the use of antimicrobials as much as possible (Bélanger et al., 2011). Antibiotic therapy helps in reducing both incidence and mortality associated with avian colibacillosis, unscrupulous use of antibiotics to prevent infections results in emergence of large numbers of drug resistant E. coli posing problems to control these infections (Sharada et al., 2010).

 

Acquired antimicrobial resistance patterns were observed in E. coli isolates with predominant patterns being distributed widely across poultry types indicating a striking diversity of resistance patterns (Okoli et al., 2005 and Persoons et al., 2010). Xia      et al. 2011 reported that Over 58% of E. coli isolates showed resistance to four or more antimicrobial agents, that indicates a need to better understand the role of certain meat types as potential sources of human ExPEC infection.

 

Different virulence-associated genes that play important roles individually or in combination in adhesion, ferric transport system, hemolyzation, and toxin-production of APEC have been reported (Ewers et al., 2004; Janben et al., 2001; Johnson et al., 2006; Mellata et al., 2003 and Yaguchi et al., 2007). EaeA gene encodes intimin, an outer membrane protein that is responsible for the attachment to the intestinal epithelial cells (Yu and Kaper, 1992). Intimin is a protein encoded by eaeA cromosomal gene and mediates adherence of attaching and effaching E. coli to the intestinal epithelial cell (Ghanbarpour and Oswald, 2010).

 

Resistance to β-lactam antimicrobial agents in E. coli is primarily mediated by β –lactamases (Livermore, 1995). These enzymes that are capable of hydrolyzing oxyimino L-lactams were isolated in the mid-1980s and are variants of the well-established TEM and SHV penicillinases (Thomson and Moland, 2000). Many different β -lactamases have been described (Bush et al., 1995; Livermore, 1995 and Livermore, 1998). The classical TEM-1, TEM-2, and SHV-1 enzymes are the predominant plasmid-mediated β –lactamases of gram-negative rods (Briñas et al., 2002).

 

Quinolone resistance in the Enterobacteriaceae is mostly mediated by point mutations in the quinolone resistance-determining regions (QRDR) of the target genes (gyrA and gyrB, which encode DNA gyrase, and parC and parE, which encode topoisomerase IV) (Fàbrega et al., 2009; Cavaco et al., 2009).Other resistance mechanisms include efflux pump mechanisms which is mediated by QepA genes (Yamane et al., 2007), and more recently, Plasmid-mediated quinolone resistance encoded by the qnr genes which comprises a group of pentapeptide repeat proteins that protect bacteria against quinolones (Tran and Jacoby, 2002), and aac(6′)-Ib-cr which is a modified aminoglycoside N-acetyltransferase that acetylates some fluoroquinolones, including Ciprofloxacin (Robicsek et al., 2006).

 

Thus the aim of this study was to investigate and characterize multidrug resistant virulent E.coli isolated from broiler flocks suffered from high mortality rates.

 

MATERIALS and METHODS

 

Collection of samples:

A total of 315 samples from heart, liver and lung were collected under aseptic conditions from 105 freshly dead or diseased birds aged from 7 - 45 days and suffering from perihepatitis, pericarditis, pneumonia, airsacculitis, peritonitis, enteritis or yolk sac infection.

 

Isolation and Identification:

Tissue samples were inoculated on MacConkey agar (HIMEDIA) incubated at 37oC for 24 hours, lactose fermenting colonies were subcultured on Eosin Methylene blue agar (HIMEDIA) incubated at 37oC for 24 hours.  Suspected E. coli colonies with metallic sheen were subjected to biochemical tests.

 

Biochemical identification:

Suspected E. coli colonies were tested biochemically by applying the following tests: (Oxidase, Catalase, Methyl Red, Vogues Proskaur, Indole, Citrate utilization, Nitrate reduction, Urease,  TSI) according to (Kreig et al., 1984).

 

Serotyping:

E. coli isolates were serotyped in Reference Laboratory for Veterinary Quality Control on Poultry Production using commercially available kits (Test Sera Enteroclon, Anti –Coli, SIFIN Berlin, Germany).

 

Antibiogram:

Antibiotic sensitivity was performed using Mueller Hinton Agar plates (HIMEDIA) using antibiotic discs of 20 commonly used antibiotics. Measuring the diameter of the inhibition zones produced was done according to (Bauer et al., 1966).

 

DNA extraction:

DNA extraction from samples was performed using the QIAamp DNA Mini kit (Qiagen, Germany, GmbH) with modifications from the manufacturer’s recommendations. Briefly, 200 µl of the sample suspension was incubated with 20 µl of proteinase K and 200 µl of lysis buffer at 56oC for 10 min. After incubation, 200 µl of 100% ethanol was added to the lysate. The sample was then washed and centrifuged following the manufacturer’s recommendations. Nucleic acid was eluted with 100 µl of elution buffer provided in the kit.

 

Oligonucleotide Primer:

Primers used were supplied from Metabion (Germany) and are listed in Table (1).

 

PCR amplification:

Primers were utilized in a 25- µl reaction containing 12.5 µl of EmeraldAmp Max PCR Master Mix (Takara, Japan), 1 µl of each primer of 20 pmol concentration, 4.5 µl of water, and 6 µl of template. The reactions were performed in a Biometra T3 thermal cycler.

 

Analysis of the PCR Products:

The products of PCR were separated by electrophoresis on 1.5% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature using gradients of 5V/cm. For gel analysis, 15 µl of the PCR products were loaded in each gel slot. A 100 bp DNA Ladder (Qiagen, Germany, GmbH) was used to determine the fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra, Germany) and the data was analyzed through computer software.

 

RESULTS

 

Incidence rate of E. coli in broiler samples:

Bacteriological examination of lung, liver and heart samples from each bird case revealed 84 (80%) E. coli isolates out of the total 105 examined birds.

 

Table 1: PCR primers used for amplification of virulence-associated genes and antibiotic resistant genes of E.coli.

 

Gene

Primers sequences

Amplified segment (bp)

Secondary denaturation

Annealing

Extension

Reference

eaeA

GACCCGGCACAAGCATAAGC

384

94˚C

45 sec.

54˚C

45 sec

72˚C

45 sec

Wen-jie JIN et al., 2008

CCACCTGCAGCAACAAGAGG

qepA

CGTGTTGCTGGAGTTCTTC

403

94˚C

45 sec.

50˚C

45 sec

72˚C

45 sec

Cattoir et al., 2008

CTGCAGGTACTGCGTCATG

qnrA

ATTTCTCACGCCAGGATTTG

516

94˚C

45 sec.

53˚C

45 sec

72˚C

45 sec

Robicsek et al., 2006

GATCGGCAAAGGTTAGGTCA

qnrB

GATCGTGAAAGCCAGAAAGG

469

ACGATGCCTGGTAGTTGTCC

qnrS

ACGACATTCGTCAACTGCAA

417

TAAATTGGCACCCTGTAGGC

aac(6′ )-Ib-cr

CCCGCTTTCTCGTAGCA

113

94˚C

30 sec.

52˚C

30 sec

72˚C

30 sec

Lunn et al., 2010

TTAGGCATCACTGCGTCTTC

blaTEM

ATCAGCAATAAACCAGC

516

94˚C

45 sec

54˚C

45 sec

72˚C

45 sec

Colom et al., 2003

CCCCGAAGAACGTTTTC

 

Table 2: Incidence of detected serotypes based on total number of E. coli isolates.

 

Serotype

Number of isolates

Incidence of serotypes

O 114:K 90

 

15

17.86%

O 125:K 70

12

14.29%

O 26:K 60

9

10.71%

O 44:K 74

3

3.57%

O 111:K 58

9

10.71%

O 55:K 59

12

14.29%

O126:K71

3

3.57%

O91:K-

6

7.14%

O 145:K -

3

3.57%

O118:K -

3

3.57%

O 25:K11

3

3.57%

Untypeable isolates

6

7.14%

Total

84

100%

 

In the present study, 84 E. coli isolates were differentiated into 3 different O groups: Poly 1, Poly 11 and Poly 111 of which 11 different serotypes were identified as follows, O 114:K 90 predominated with 17.86% of the total isolates, followed by O125:K 70 and O 55:K 59 with 14.29% each, O 111:K 58 and O 26:K 60 with 10.71% each. 7.14% of the isolates were untypeable using the commercially available kits, while all of the rest 5 identified serotypes had the same isolation rate 3.57% which were O 145:K -, O 25:K 11, O 44:K 74, O126:K71, O118:K -.

 


Table 3: The distribution of different serotypes in relation to organs of isolation.

 

 

Isolation rate  

 

Serotypes %

Serotypes

Serogroups

Organ  of isolation

 57.14% (60)

 

 

 

90.91% (10)

9- O 114:K 90

9- O 125:K 70

3- O 26:K 60

3- O 44:K 74

Poly 1

 

Liver

9- O 111:K 58

9- O 55:K 59

3- O126:K71

6- O91:K-

Poly 11

3- O 145:K -

3- O118:K -

Poly 111

3 –isolates

Untypeable

37.14% (39)

63.64% (7)

12- O 114:K 90

3- O 125:K 70

6-O 26:K 60

Poly 1

 

Heart

3- O 55:K 59

Poly 11

3- O145:K -

3-O25:K 11

3- O118:K -

Poly 111

6 – isolates

Untypeable

54.29% ( 57)

 

72.73% (8)

 

 

9-O 114:K 90,

12- O125:K 70,

6-O 26:K 60,

3- O44:K 74,

Poly 1

 

Lung

 

 

9- O 111:K 58

6- O 55:K 59

Poly 11

3- O 145:K -

3- O118:K -

Poly 111

6- isolates

Untypeable

The maximum isolation percentagewas from liver: 60 (57.14%), while there were 39 (37.14%) and 57 (54.29%) from heart and lung, respectively.

 

Table 4:Antibiotic susceptibility pattern of the isolates.

 

Sensitive

Resistant

Conc.of disc  

Symbol

Chemotherapeutic agent

SN

Antibiotic group

3.57%

96.43%

5 ug

P

Penecillin

1

Penicillins

7.14%

92.86%

25 ug

AMX

Amoxicillin

2

7.14%

92.86%

10 ug

AMP

Ampicillin

3

17.86%

82.14%

30 ug

C

Chloramphinicol

4

Nitrobenzene drevatives

89.29%

10.71%

10 u

CT

Colistin

5

Peptides

3.57%

96.43%

2 ug

L

Lincomycin

6

Macrolydes

32.14%

67.86%

15 ug

E

Erythromycin

7

7.14%

92.86%

30 ug

UB

Flumequine

8

1st Generation Quinolones

3.57%

96.43%

30 ug

NA

Nalidixic A

9

75%

25%

5 ug

O

Ciprofloxacin

10

2nd  Generation Quinolones

10.71%

89.26%

5 ug

D

Danofloxacin

11

7.14%

92.86%

10 ug

ENR

Enrofloxacin

12

10.71%

89.26%

10 ug

NOR

Norfloxacin

13

25%

75%

30 ug

N

Neomycin

14

Aminoglycosides

50%

50%

10 ug

GM

Gentamycin

15

7.14%

92.86%

10 ug

S

Streptomycin

16

0%

100%

30 ug

DFX

Doxycycline

17

Tetracyclines

3.57%

96.43%

30 ug

TE

Tetracycline

18

3.57%

96.43%

30 ug

OT

Oxytetracycline

19

17.86%

82.14%

1.25 ug

SXT

Trimethoprime

20

Diaminopyrimidine

 

The sensitivity and resistance pattern of E. coli isolates for various antibiotics were tested, it was observed that none of the used antibiotics was 100 % effective, on the other hand, multidrug resistance patterns have been recorded among all isolates. Out of the total tested 84 isolates,  6 (7.1%) were resistant to the 20 used antibiotics, 9 (10.7%) were resistant to 19 antibiotics,  15 (17.9%) were resistant to 18 antibiotics, 18 (21.4%) were resistant to 17 antibiotics, 12 (14.3%) were resistant to 16 antibiotics, 9 (10.7%) were resistant to 15 antibiotics, 9 (10.7%) were resistant to 14 antibiotics, 3 (3. 6%) were resistant to 13 antibiotics and 3 (3.6%) were resistant to 6 antibiotics.

 

Prevalence of virulence-associated genes and antibiotic resistance genes in E. coli are shown in Table (5), Fig. (1) and Fig. (2). Among 7 tested genes, the most prevalent gene was blaTEM gene (78.6%) and the least prevalent ones were aac(6′)-Ib-cr and qnrA (21.4%).

 

Table 5: Individual PCR results of the different tested genes for the isolated serotypes.

 

 

Serotype

Quinolone resistance genes

Virulence

β–lactamase

qepA

qnrA

qnrB

qnrS

aac(6′)-Ib-cr

eaeA

blaTEM

O 114:K 90

 

+

-

-

+

-

+

+

O 145:K -

+

-

+

+

-

+

+

O 25:K 11

+

-

-

+

-

+

+

O125:K70

-

-

-

-

-

+

+

O 111:K 58

+

-

-

-

-

+

+

O 44:K 74

+

-

+

+

-

-

+

O 125:K 70

+

+

+

+

+

+

+

O126:K71

-

+

+

+

-

+

+

O91:K-

+

-

+

+

-

+

+

O 55:K 59

-

-

-

-

+

-

-

O 26:K60

-

-

-

-

+

-

-

O91:K-(x)

-

-

-

-

-

-

-

O118:K -

+

+

+

+

-

+

+

O 26:K 60

+

-

+

+

-

+

+

Pos / Total

9/14

3/14

7/14

9/14

3/14

10/14

11/14

 

 

 

 

8

7

6

L

5

4

3

2

1

 

 

 

 

600

 

100

1500

 

 

 

300

 

 

100

 

 

 

 

 

 

 

 

 

 

 


Fig. 1: PCR results for virulence-associated gene containing E. coli isolates and antibiotic resistant genes. L, 100 bp ladder (QIAGEN, Gmbh) (100-600 bp). 1-8 lanes were respectively: 1) Negative control, 2) qepA (403 bp), 3) qnrA  (516 bp), 4) qnrB (469 bp), 5) qnrS (417 bp), 6) aac(6′)-Ib-cr (113 bp), 7) blaTEM (516 bp) and 8) eaeA (384 bp).

Fig. 2Detection percentages of the different tested genes by PCR.

 

 

 

 

 

 

DISCUSSION

 

In the present study, E. coli was recoveredfrom 84 (80%) out of the total examined 105 freshly dead or diseased cases. A lower rate was recorded by(Zhao  et al., 2001; Sharada et al., 2010; Hasan et al., 2011 and Literak et al., 2013) who isolated E. coli with the percentages of 38.7%, 44.61% , 36.20% and 35.74%, respectively. Higher rates were recorded by (Johnson  et al., 2005 and Lyhs et al., 2012)who recovered     E. coli in 92% and 94.5% of the tested samples, respectively.

 

Regarding isolation rates from different organs with pathologic conditions, the maximum rate was recorded in liver showing perihepatitis 60 (57.14%), followed by lung showing pneumonia 57 (54.29%) and the least percentage was recorded from heart (pericarditis) 39 (37.14%) out of the examined 105 organs from each type (liver, lung and heart). These findings are in accordance with (Sharada et al., 2010) who recorded the highest percentage of isolation in their study from liver samples (44.61%) and the lowest percentage was from heart samples (16.92%). Isolation rates from liver, heart and lung was inaccordance with (Ghosh, 1988; Krishnamohan and Koteeswaran, 1994 and Sharada et al., 2010) who reported the association of perihapatitis and pericarditis and stated that this association confirmed the high virulence of E. coli isolates causing the aforementioned pathologic conditions.

 

In the present study, serotyping of the isolated E. coli revealed 11 different serotypes which were identified as follows, O 114:K 90 predominates with 17.86% of the total isolates, O 125:K 70 and O 55:K 59 with  14.29% each, O 111:K 58 and O 26:K 60 with 10.71%, while 7.14% of isolates were untypeable using the commercially available kits, while all of the  identified serotypes were detected  with 3.57% isolation rate which were O 145:K, O 25:K 11, O 44:K 74, O126:K71, O118:K. These results agreed with those of(Rosarioet al., 2004and Ohet al., 2012) who failed to identify the serogroup of 15% and 50% out of their tested isolates, respectively. Saif et al. 2003 stated that there are variations according to the geographic region and that some pathogenic isolates do not belong to known serotypes or are untypeable. They also reported that only 15% of the strains belonged to the serogroups O1, O2, O35, O36, and O78 that have been associated previously with avian colibacillosis were isolated from diseased birds, suggesting that this might signal the emergence of new pathogenic serotypes. Zhaoet al., 2005 reported that the majority of the avian E. coli isolates (60%) were non-typeable with the standard available antisera.

 

The Results for Antibiotic sensitivity showed that all the isolates demonstrated multidrug resistance against most of the 20 types of antibiotics used. This agreed with (Yanget al., 2004; Johnson et al., 2005; Wanget al., 2010; Hasanet al., 2011 and Jiang       et al., 2009)who recorded that multiple-antimicrobial resistant E. coli isolates, including fluoroquinolone-resistant variants are commonly present among diseased chickens. Our results for multidrug resistant isolates also agreed with that of (Triciaet al., 2006) who stated that avian E. coli isolates that were tetracycline resistant are more likely to become resistant to additional antimicrobial agents as kanamycine and nalidixic acid.

 

The study recorded maximum resistance against tetracyclines; as resistance against doxycyclin was 100% followed by tetracycline, oxytetracyclin which were both 96.43%. This results agreed with that of (Zhanget al., 2012-b; Ionica, 2011 and Jianget al., 2009)who recorded resistance to doxycyclin and tetracycline (70.12%, 84.76%), (95.6%, 93.4%) and (97,62%, 90,48%), respectively.Lower rates were observed against tetracyclines by(Guerraet al., 2003;  Hasanet al., 2011 and Xiaet al., 2011)which were  (15-30%),(45.5%) and (67.0%), respectively.

 

The present study recorded resistance rates against penicillin (96.43%), and 92.86% for ampicillin, and amoxicillin. These findings agreed with those of (Yanget al., 2004; Liet al., 2007and Jianget al., 2009) whoreported resistance to ampicillin by the percentages of 79%, 99.5% and 83%, respectively. lower resistance rates were recorded to ampicillin by (Guerraet al., 2003; Sharada et al., 2010 and Hasan et al., 2011)who recorded the resistance with the percentages of 25.7%, 27.69% and 15-30%, respectively.

 

The present study revealed that 96.43% of the E.coli isolates were resistant to nalidixic acid. This finding disagreed with those of (Guerra et al., 2003; Johnson et al., 2003 and Amy et al., 2010) who recorded resistance rates of (11%), (37%) and (41.5%), respectively, almost similar results were recorded by (Yanget al., 2004and Salehi and Farashi, 2006) (100%) both.

 

The study showed resistance percentages to lincomycin of 96.43%. Almost similar resistance were detected by (Salehi and Farashi, 2006 and Ionica, 2011) who reported 100% and 80.95% resistance percentages, respectively. lower rates were detected by (Al-Saati et al., 2009 and Sharada et al., 2010)(5% and 39.50%, respectively).

 

The highest sensitivity rate detected in our study was to colistin 89.29%. This result agreed with that of (Galaniet al., 2008)who reported that colistin exhibited excellent activity against Escherichia coli isolates, and also agreed with (Al-Saati et al., 2009; Sharada et al., 2010 and Ionica, 2011) who observed  94.00%, 95% and 61.90% sensitivity rates, respectively.

 

The study showed high sensitivity rate to ciprofloxacin (75%). This finding agreed with those of (Bogaard et al., 2001; Al-Saati et al., 2009; Hasan et al., 2011and Lyhset al., 2012) who recorded 90%, 95%, 87.1% and 100% sensitivity rates, respectively. Our results of sensitivity to ciprofloxacin disagreed with those of (Yang et al., 2004; Li, et al., 2007 and Wanget al., 2010) who detected high resistance rates (79%, 81% and 87%, respectively).

 

It was also reported that 50% sensitivity rate was found to gentamycin. Similar resistance rates were recorded by (Mahmood and Reza, 2010; Sharada      et al., 2010and Zhanget al., 2012-a) who reported 54.5%, 60% and 60%, respectively. Lower rate (31%) were detected by (Zhaoet al., 2005). Higher sensitivity rates were detected by (Salehi and Farashi, 2006; Hasanet al., 2011 and Ionica, 2011) (100%,98% and 90.48%, respectively).

 

The results of Antibiotic susceptibility of our study are invariance with some studies and inaccordance with others, indicating that antibiotic suscebtibility pattern varies with different isolates, time and development of multiple drug resistant E.coli. as reported by (Holmberget al., 1984  and Sharada       et al., 2010).

 

Attaching and effaching was a term to describe an intestinal lession (AE lesion) caused by specific strains of E. coli. ’Attaching’ because of the intimate attachment of the bacteria to the exposed cytoplasm membrane of the enyterocyte; and ’effaching’ because of the localized disapperance of the brush border microvilli (Stordeur et al., 2000). This was represented in our results by the high incidence rate (71.4%) of eaeAgene detection that was recorded, as it was detected by PCR in 10 isolates out of the 14 tested isolates. The high incidence rate of eaeA gene detection was recorded by many authors as (Suardana et al., 2011 and El-Jakee et al., 2012) who detected eaeA gene in 95% and 95.9% of the tested E. coli O157:H7 isolates, respectively. The eaeA gene was detected also in a lower prevalence rate (25%) in the wild birds and it was suggested that most of the E. coli strains are probably related to atypical EPEC strains found in humans as reported by (Kobayashi et al., 2009). However, no eaeA gene was detected among 216 APEC isolates tested by (Wen-jie et al., 2008)who supporeted the results by that obtained by (Krause et al., 2005) who reported a low detection rate (2.3%) of eaeA gene in the tested E. coli isolates from fecal samples of healthy chickens.

 

PCR detected 11 positive isolates for blaTEM out of the 14 tested isolates (78.6%). This results agreed with the results of the antibiogram test in which all of the PCR tested isolates were resistant to Penicillins (Penicillin, Amoxicillin and Ampicillin). The high incidence of blaTEM detection in E. coli was previously recorded by many authors as (Colom       et al., 2003) who detected blaTEM gene in 45 out of 51 Amoxicillin-clavulanate resistant E. coli isolates with 88.2%. The high blaTEM gene prevalence was recorded by (Brinas et al., 2002) who detected the gene in 83% of 124 Ampicillin resistant E. coli isolates including food isolates of chicken origin. A close blaTEM detection percentage to our results was detected also by (Yuan et al., 2009) who detected this gene in 79.3% of the chinese E. coli isolates that were studied for Extended-spectrum b-lactamase (ESBL) production.

 

Quinolones are synthetic compounds that have been used extensively for treatment of a variety of infectious diseases. (Hooper, 2001). This wide spread use has been followed by increasing bacterial resistance (Tran and Jacoby, 2002). QepA is a plasmid-encoded efflux pump that significantly affects susceptibility to Norfloxacin (Yamane et al., 2007).This was reported in our results, as all of the strains that showed positive amplification of the qepA gene showed resistance to Norofloxacin by the antibiotic sensitivity test. As shown in Table (6) and Fig. (2), the detection percentages of the qepA, qnrA, qnrB, qnrS and aac(6′)-Ib-cr genes were 64.2%, 21.4%, 50%, 64.2% and 21.4%, respectively. The percentages was much higher than most of the previously reported results by the researchers worked at this field as (Chen et al., 2012) who detected each of the qepA, qnrB, qnrS in 1.3% of the isolates and detected aac(6′)-Ib-cr gene in 3.1% of the isolates, but the qnrA gene was not detected in any of the 384 chicken isolates. Also, the qnrS gene, but not qnrA, qnrB, and qepA genes were detected in 6/300 chicken isolates (2%) from 30 chicken farms in Taiwan (KUO et al., 2009). Only qnrA gene was found in 5.3% of   E. coli isolates, while qnrB and qnrS were not detected when (MÜSTAK et al., 2012) tested 94 chicken E. coli isolates for the three mentioned genes. However, some researchers reported high incidence of the quinolones resistant genes as (Wang et al., 2008) who detected qnrA in 72.7% of the isolates and detected each of the qnrB and qnrS genes in 45.4% of the 14 E. coli isolates tested. However, the high incidence of the detected genes in our results and in the previously mentioned researcher results may be due to the low number of the tested isolates.

 

Our study reported the high incidence of virulent multidrug resistant E. coli isolates among diseased broiler flocks, this is in accordance with (Okoli et al., 2005; Persoons et al., 2010 and Xia et al., 2011).

 

REFERENCE

 

Al-Saati, T.M.S.; Al-Emadi, M.A. and Habra, N. (2009): Effect of some antibiotics on Escherichia coli isolates from broiler chicks in some regions of Syria. Iraqi journal.

Amy D. Lunn; Anna Fàbrega; Javier Sلnchez-Céspedes and Jordi Vila (2010): Prevalence of mechanisms decreasing quinolone-susceptibility among International Microbiology (2010) 13:15-20. Arch. Razi Ins. (1999) 50.

Bauer A.W.; Kirby, W.M.M.; Sheris, J.C. and Truk, M. (1966): Antibiotic susceptibility testing by a standardized single disc method. American J. Clinical Pathol.,145: 225/230.

Bélanger, L.Garenaux, A.; Harel, J.; Boulianne, M.; Nadeau, E. and Dozois, C.M. (2011): Escherichia coli from animal reservoirs as a potential source of human extraintestinal pathogenic E. coli. FEMS Immunol Med. Microbiol. 2011 Jun; 62 (1):1-10. doi: 10.1111/j.1574-695X.2011.00797.x.

Bogaard E. van den; London, N.; Driessen, C. and Stobberingh, E.E. (2001): Antibiotic resistance of faecal Escherichia coli in poultry, poultry farmers and poultry slaughterers. J. Antimicrob. Chemother. (2001)47 (6): 763-771. doi: 10.1093/jac/47.6.763.

Briñas, l.; Zarazaga, M.; Sãenz, Y.; Ruiz-Larrea, F. and Torres, C. (2002): β -Lactamases in Ampicillin-Resistant Escherichia coli Isolates from Foods, Humans, and Healthy Animals. Antimicrobial Agent and Chemotherapy, p. 3156–3163. Vol. 46, No. 10.

Bush, K.; Jacoby, G.A. and Medeiros, A.A. (1995): A functional classification scheme for beta-lactamases and its correlation with molecular structures. Antimicrob. Agents Chemother. 39: 1211–1233.

Cattoir, V.; Poirel, L. and Nordmann, P. (2008): Plasmid-mediated quinolone resistance pump QepA2 in an Escherichia coli isolate from France. Antimicrob Agents Chemother 52: 3801-3804.

Cavaco, L.M.; Hasman, H.; Xia, S. and Aarestrup, F.M. (2009): QnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbifican strains of human origin. Antimicrob. Agents Ch., 53: 603–608.

Chen, X.; Zhang, W.; Pan, W.; Yin, J.; Pan, Z.; Gao, S. and Jiao, X. (2012): Prevalence of qnr, aac (6′)-Ib-cr, qepA, and oqxAB in Escherichia coli Isolates from Humans, Animals, and the Environment. Antimicrobial Agents and Chemotherapy p. 3423–3427. Volume 56 Number 6.

Colom, K.; Pèrez, J.; Alonso, R.; Fernández-Aranguiz, A.; Lariňo, E. and Cisterna, R. (2003): Simple and reliable multiplex PCR assay for detection of blaTEM, blaSHV and blaOXA-1 genes in Enterobacteriaceae. FEMS Microbiology Letters 223 (2003) 147-151.

El-Jakee, J.K.; Mahmoud, R.M.; Samy, A.A.; El-Shabrawy, M.A.; Effat, M.M. and Gad El-Said, W.A. (2012):Molecular Characterization of E. coli Isolated from Chicken, Cattle and Buffaloes. International Journal of Microbiological Research 3 (1): 64-74.

Ewers, C.; Janssen, T.; Kiessling, S.; Philipp, H.C. and Wieler, L.H. (2004):Molecular epidemiology of avian pathogenic Escherichia coli (APEC) isolated from colisepticemia in poultry. Veterinary Microbiology, 104,        91-101.

Fàbrega, A.; Madurga, S.; Giralt, E.; Vila, J. (2009): Mechanism of action of and resistance to quinolones. Microb Biotechnol 2: 40-61.

Galani, I.; Kontopidou, F.; Souli, M.; Rekatsina, P.D.; Koratzanis, E.; Deliolanis, J. and Giamarellou, H. (2008): Colistin susceptibility testing by Etest and disk diffusion methods. Int J. Antimicrob Agents. 2008 May; 31(5): 434-9.

Ghanbarpour, R. and Oswald, E. (2010): Phylogenetic Distribution of Virulence Genes in Escherichia coli Isolated from Bovine Mastitis in Iran. Res. Vet. Sci., 88, 6-10.

Ghosh, S.S. (1988): E. coli serotypes of poultry in Nagaland. Indian J. Animal Res., 22:35-38.

Guerra, B.; Junker, E.; Schroeter, A.; Malorny, B.; Lehmann, S. and Helmuth, R. (2003): Phenotypic and genotypic characterization of antimicrobial resistance in German Escherichia coli isolates from cattle, swine and poultry. J. Antimicrob Chemother. 2003 Sep; 52 (3): 489-92.

Hasan, B.; Faruque, R.; Drobni, M.; Waldenström, J.; Sadique, A.; Ahmed, K.U.; Islam, Z.; Parvez, M.B.; Olsen, B. and Alam, M. (2011): High prevalence of antibiotic resistance in pathogenic Escherichia coli from large- and small-scale poultry farms in Bangladesh. Avian Dis. 2011 Dec; 55(4):689-92.

Holmberg, S.D.; Osterman, M.T. and Senger, K.A. (1984): Drug resistant E. coli from animal fed antimicrobial, New England J. Medicine, 311: 617-622.

Hooper, DC. (2001): Emerging mechanisms of fluoroquinolone resistance. Emerg. Infect. Dis. 7: 337–341.

Ionica FODOR (2011): Antimicrobial Susceptibility of E. coli Strains Isolated from a Colisepticemia Outbreak in Broilers. Bulletin UASVM, Veterinary Medicine 68(2)/2011.

Janben, T.; Schwarz, C.; Preikschat, P.; Voss, M.; Philipp, H.C. and Wieler, L.H. (2001): Virulence-associated genes in avian pathogenic Escherichia coli (APEC) isolated from internal organs of poultry having died from colibacillosis. International Journal of Medical Microbiology, 291, 371-378.

Jiang, H.X.; Lü, D.H.; Chen, Z.L.; Wang, X.M.; Chen, J.R.; Liu, Y.H.; Liao, X.P.; Liu, J.H. and Zeng, ZL. (2009): High prevalence and widespread distribution of multi-resistant Escherichia coli isolates in pigs and poultry in China. Vet J. 2011 Jan; 187(1): 99-103. doi: 10.1016/j.tvjl.2009.10.017.

Johnson, J.R.; Kuskowski, M.A.; Smith, K.; O'Bryan, TT. and Tatini, S. (2005): Antimicrobial-resistant and extraintestinal pathogenic Escherichia coli in retail foods. J Infect Dis. 2005 Apr 1; 191(7):1040-9.

Johnson, J.R.; Murray, A.C.; Gajewski, A.; Sullivan, M.; Snippes, P.; Kuskowski, M.A. and Smith, K.E. (2003): Isolation and molecular characterization of nalidixic acid-resistant extraintestinal pathogenic Escherichia coli from retail chicken products. Antimicrob Agents Chemother. 2003 Jul; 47(7):2161-8.

Johnson, T.J.; Siek, KE.; Johnson, SJ. and Nolan, LK. (2006): DNA sequence of a ColV plasmid and prevalence of selected plasmid-encoded virulence genes among avian Escherichia coli strains. Journal of Bacteriology, 188, 745-758.

Kobayashi, H.; Kanazaki, M.; Hata, E. and Kubo, M. (2009): Prevalence and Characteristics of eae- and stx-Positive Strains of Escherichia coli from Wild Birds in the Immediate Environment of Tokyo Bay. Applied and Environmental Microbiology, p. 292–295. Vol. 75, No. 1.

Krause, G.; Zimmermann, S. and Beutin, L. (2005): Investigation of domestic animals and pets as a reservoir for intimin-(eae) gene positive Escherichia coli types. Veterinary Microbiology, 106, 87-95.

Kreig N.R.; J.G. Holt; Williams and Wilkins, (1984): Bergeys Manual of Systematic Bacteriol.,1:428, East Preston street, Baltimor, M.D.21202, USA.

Krishnamohan Reddy, Y. and Koteeswaran, A. (1994): Studies on experimental E. coli infection in Japanese quail. Indian Veterinary J., 71:959-963.

Kuo, H.C.; Chou, C.C.; Tu, C.; Gong, S.R.; Han, C.L.; Liao, J.W. and Chang, S.K. (2009): Characterization of plasmid-mediated quinolone resistance by the qnrS gene in Escherichia coli isolated from healthy chickens and pigs. Veterinarni Medicina, 54, 2009 (10): 473–482.

Li, X.S.Wang, G.Q.Du, X.D.; Cui, B.A.; Zhang, S.M. and Shen, J.Z. (2007): Antimicrobial susceptibility and molecular detection of chloramphenicol and florfenicol resistance among Escherichia coli isolates from diseased chickens. J. Vet. Sci. 2007 Sep; 8(3): 243-7.

Literak, I.; Reitschmied, T.; Bujnakova, D.; Dolejska, M.; Cizek, A.; Bardon, J.; Pokludova, L.; Alexa, P.; Halova, D. and Jamborova, I. (2013): Broilers as a Source of Quinolone-Resistant and Extraintestinal Pathogenic Escherichia coli in the Czech Republic. Microb Drug Resist. 2013 Feb; 19(1):57-63. doi: 10.1089/mdr.2012.0124.

Livermore, DM. (1995):β -Lactamases in laboratory and clinical resistance. Clin. Microbiol. Rev. 8:557–584.

Livermore, DM. (1998): Beta-lactamase-mediated resistance and opportunities for its control. J. Antimicrob. Agents 41(Suppl. D):25–41.

Lunn, A.D.; Fàbrega, A.; Sánchez-Céspedes, J. and Vila, J. (2010): Prevalence of mechanisms decreasing quinolone-susceptibility among Salmonella spp. clinical isolates. International Microbiology. 13:15-20.

Lyhs,  U.;  Ikonen,  I.;  Pohjanvirta, T.;  Raninen,  K.; Perko-Mäkelä, P. and Pelkonen, S. (2012): Extraintestinal pathogenic Escherichia coli in poultry meat products on the Finnish retail market. Acta. Vet. Scand. 2012 Nov 16;54:64. doi: 10.1186/1751-0147-54-64.

Mahmood Salehi and Reza Ghanbarpour (2010): Characterization of Escherichia coli Isolates from Commercial Layer Hens with Salpingitis. American Journal of Animal and Veterinary Sciences 5 (3): 208-214, 2010.

Manges, A.R. and Johnson, J.R. (2012): Food-Borne Origins of Escherichia coli Causing Extraintestinal Infections. Clin Infect Dis. 2012 Jun 7.

Mellata, M.; Dho-Moulin, M.; Dozois, C.M.; Curtiss, R.III.; Brown, P.K.; Arné, P.; Brée, A.; Desautels, C. and Fairbrother, JM. (2003): Role of virulence factors in resistance of avian pathogenic Escherichia coli to serum and in pathogenicity. Infection and Immunity, 71, 536-540.

MÜŞTAK, H.K.; ICA, T.; CIFTCI, A. and DİKER, K.S. (2012): Plasmid-mediated quinolone resistance in Escherichia coli strains isolated from animals in Turkey. Ankara Üniv. Vet. Fak Derg, 59, 255-258.

Oh, J.Y.; Kang, M.SAn, B.K.; Shin, E.GKim, M.J; Kim, Y.J. and Kwon, Y.K. (2012): Prevalence and characteristics of intimin-producing Escherichia coli strains isolated from healthy chickens in Korea. Poult Sci. 2012 Oct; 91(10):2438-43.

Okoli, C.I.; Chah, K.F.; Ozoh, P.T.E. and Udedibie, A.B.I. (2005): Anti Microbial Resistance Profile of E. coli isolates From Tropical Free Range Chickens. OJHAS: Vol 4, Issue3: (2005 Jul-Sep).

Persoons, D.; Dewulf, J.; Smet, A.; Herman, L.; Heyndrickx, M.; Martel, A.; Catry, B.; Butaye, P. and Haesebrouck, F. (2010): Prevalence and persistence of antimicrobial resistance in broiler indicator bacteria. Microb Drug Resist. 2010 Mar; 16(1): 67-74.

Robicsek, A.; Strahilevitz, J.; Sahm, D.F.; Jacoby, G.A. and Hooper, D.C. (2006): Qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob Agents Chemother 50: 2872-2874.

Rosario, C.C.; López, A.C.; Téllez, I.G.; Navarro, O.A.; Anderson, R.C. and Eslava, C.C. (2004): Serotyping and virulence genes detection in Escherichia coli isolated from fertile and infertile eggs, dead-in-shell embryos, and chickens with yolk sac infection. Avian Dis. 2004 Dec; 48(4):       791-802.

Saif, Y.M. and Colibacillosis, CH. (2003): Diseases of poultry, 18, (631-656)-11th ed.

Salehi T. Zahraei and Farashi Bonab, S. (2006): Antibiotics Susceptibility Pattern of Escherichia coli Strains Isolated from Chickens with Colisepticemia in Tabriz Province, Iran. International Journal of Poultry Science, 2006, vol 5: 677-684.

Sharada, R.; Wilfred Ruban, S. and Thiyageerswaran, M. (2010): Isolation, Characterization and Antibiotic Resistance Pattern of Echerichia coli Isolated from Pourltry. American –Eurasian Journal of Scientific Research 5(1): 18-22, 2010.

Stordeur, P.; China, B.; Charlier, G.; Roels, S. and Mainil, J. (2000): Clinical Signs, Reproduction of Attaching/Effacing Lessions, and Enterocyte Invasion after Oral Inoculation of an O118 Enterohaemorrhagic Escherichia coli in Neonatal Calves. Microbes and Infection. 2, 17-24.

Suardana, I.W.; Artama, W.T.; Asmara, W. and Daryono, B.S. (2011): Adherence Pheno-genotypic of Escherichia coli O157:H7 Isolated from Beef, Feces of Cattle, Chicken and Human. Indonesian Journal of Biotechnology. Vol. 16, No. 1, pp.46-52.

Thomson, K. and Moland, E.S. (2000): Version 2000: The new β-lactamases of gram-negative bacteria at the dawn of the new millennium. Microb. Infect. 2, 1225-1235.

Tran, J.H. and Jacoby, G.A. (2002): Mechanism of plasmid-mediated quinolone resistance. Proc Natl Acad Sci USA 99: 5638-5642.

Tricia D. MilesWayne McLaughlin and Paul D Brown (2006): Antimicrobial resistance of Escherichia coli isolates from broiler chickens and humans. Published online 2006 February 6. doi: 10.1186/1746-6148-2-7.

Wang, A.; Yang, Y.; Lu, Q; Wang, Y.; Chen, Y.; Deng, L.; Ding, H.; Deng, Q.; Zhang, H.; Wang, C.; Liu, L.; Xu, X.; Wang, L. and Shen, X. (2008): Presence of qnr gene in Escherichia coli and Klebsiella pneumoniae resistant to ciprofloxacin isolated from pediatric patients in China. BMC Infectious Diseases. 8:68.

Wang, X.M.; Liao, X.P.; Zhang, W.J.; Jiang, H.X.; Sun, J.; Zhang, M.J.; He, X.F.; Lao, D.X. and Liu, Y.H. (2010): Prevalence of serogroups, virulence genotypes, antimicrobial resistance, and phylogenetic background of avian pathogenic Escherichia coli in south of China. Foodborne Pathog Dis. 2010 Sep; 7 (9):1099-106. doi:10.1089/fpd.2010.0542.

Wen-jie, J.; Zhi-ming, Z.; Yong-zhi, Z.; Ai-jian, Q.; Hong-xia, S.; Yue-long, L.; Jiao, W. and Qian-qian, W. (2008): Distribution of Virulence-Associated Genes of Avian Pathogenic Escherichia coli Isolates in China. Agricultural Sciences in China, 7(12):      1511-1515.

Xia, X.; Meng, J.; Zhao, S.; Bodeis-Jones, S.; Gaines, S.A.; Ayers, S.L. and McDermott, P.F. (2011): Identification and antimicrobial resistance of extraintestinal pathogenic Escherichia coli from retail meats. J Food Prot. 2011 Jan; 74(1): 38-44.

Yaguchi, K.; Ogitani, T.; Osawa, R.; Kawano, M.; Kokumai, N.; Kaneshige, T.; Noro, T.; Masubuchi, K. and Shimizu, Y. (2007): Virulence factors of avian pathogenic Escherichia coli strains isolated from chickens with colisepticemia in Japan. Avian Diseases, 51, 656-662.

Yamane, K.; Wachino, J. and Suzuki, S. (2007): New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob Agents Chemother 51: 3354-3360.

Yang, H.; Chen, S.; White, D.G.; Zhao, S.; McDermott, P.; Walker, R. and Meng, J. (2004): Characterization of multiple-antimicrobial-resistant Escherichia coli isolates from diseased chickens and swine in China. J. Clin Microbiol. 2004 Aug; 42(8): 3483-9.

Yu, J. and Kaper, J.B. (1992): Cloning and Characterization of The eae gene of Enterohaemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 6, 411–417.

Yuan, L.; Liu, J.; Hu, G.; Pan, Y.; Liu, Z.; Mo, J. and Wei, Y. (2009): Molecular characterization of extended-spectrum β -lactamase-producing Escherichia coli isolates from chickens in Henan Province, China. Journal of Medical Microbiology, 58, 1449–1453.

Zhang, T.; Wang, C.G.; Jiang, G.E.; Lv, JC. and Zhong, XH. (2012)-(a): Molecular epidemiological survey on aminoglycoside antibiotics-resistant genotype and phenotype of avian Escherichia coli in North China. Poult Sci. 2012 Oct; 91(10): 2482-6.

Zhang, T.; Wang, C.G.; Lv, JC.; Wang, R.S. and  Zhong, X.H. (2012)-(b): Survey on tetracycline resistance and antibiotic-resistant genotype of avian Escherichia coli in North China. Poult Sci. 2012 Nov; 91(11): 2774-7. doi: 10.3382/ps.2012-02453.

Zhao, C.; Ge, B.; De Villena, J.; Sudler, R.; Yeh, E.; Zhao, S.; White, D.G.; Wagner, D. and Meng, J. (2001): Prevalence of Campylobacter spp., Escherichia coli, and Salmonella serovars in retail chicken, turkey, pork, and beef from the Greater Washington, D.C., area. Appl Environ Microbiol. 2001 Dec; 67(12):5431-6.

Zhao, S.; Maurer, J.J.; Hubert, S.; De Villena, J.F.; McDermott, P.F.; Meng, J.; Ayers, S.; English, L. and White D.G. (2005): Antimicrobial susceptibility and molecular characterization of avian pathogenic Escherichia coli isolates. Vet. Microbiol. 2005 May 20; 107(3-4): 215-24.

 

 

 

عزل وتوصيف ميکروب الاشيرشيا کولاى المصاحب لحالات النفوق المرتفع في قطعان الدجاج.

 

سماح عيد عبد السلام ، أحمد محمد عبد الرحمن عرفان

Email: samaheid@ymail.com

 

تم جمع عينات من 105 حالة دجاج تسمين تعانى من ارتفاع الوفيات بمحافظة الشرقية. تم عزل الأشريشيا کولاي من 84 حالة (80%). تم عزل 11 نمط مصلى مختلف وکان أکثرها هو O114:K90 بنسبة 17.86% من المعزولات. کما تم عزل الأنماط125:K70  و O55:K59 و O111:K58 و O26:K60 بنسب 14.29% و 14.29% و 10.71% و 10.71% على الترتيب. کما تم عزل 5 أنماط مصلية مختلفة بنفس النسبة 3.57% وهذه الأصناف هي O145:K – و O25:K11 و O44:K74 و O126:K71 و O118:K –. وکانت نسبة المعزولات الغير مصنفة هي 7.14%. دراسة حالات مقاومة المضادات الحيوية للمعزولات أظهرت تعدد مقاومتها للمضادات الحيوية. تم تسجيل أعلى نسبة مقاومة للدوکسيسيکلين (100%), بينما کانت نسب المقاومة للبنسلين واللينکوميسين وحمض الناليديکسيک والتتراسيکلين والأوکسيتتراسيکلين 96.4% لکل منهم. بينما کانت أعلى نسبة للحساسية 89.3% للکولستين و 75% للسيبروفلوکساسين و50% للجينتاميسين. تم فحص بعض المعزولات لجين eaeA المسئول عن الاتصال بواسطة اختبار تفاعل انزيم البلمرة لتحديد ضراوة المعزولات. کما تم الکشف عن الجينات المسئولة عن المقاومة للکينولونات مثل جين qnrA و qnrB و qnrS و qepA و  aac(6′)-Ib-cr. کما تم تحديد المقاومة للأموکسيسيللين بالکشف عن جين blaTEM المسئول عن انزيمات β-lactamases.

    

 

 

 

 
REFERENCE
 
Al-Saati, T.M.S.; Al-Emadi, M.A. and Habra, N. (2009): Effect of some antibiotics on Escherichia coli isolates from broiler chicks in some regions of Syria. Iraqi journal.
Amy D. Lunn; Anna Fàbrega; Javier Sلnchez-Céspedes and Jordi Vila (2010): Prevalence of mechanisms decreasing quinolone-susceptibility among International Microbiology (2010) 13:15-20. Arch. Razi Ins. (1999) 50.
Bauer A.W.; Kirby, W.M.M.; Sheris, J.C. and Truk, M. (1966): Antibiotic susceptibility testing by a standardized single disc method. American J. Clinical Pathol.,145: 225/230.
Bélanger, L.Garenaux, A.; Harel, J.; Boulianne, M.; Nadeau, E. and Dozois, C.M. (2011): Escherichia coli from animal reservoirs as a potential source of human extraintestinal pathogenic E. coli. FEMS Immunol Med. Microbiol. 2011 Jun; 62 (1):1-10. doi: 10.1111/j.1574-695X.2011.00797.x.
Bogaard E. van den; London, N.; Driessen, C. and Stobberingh, E.E. (2001): Antibiotic resistance of faecal Escherichia coli in poultry, poultry farmers and poultry slaughterers. J. Antimicrob. Chemother. (2001)47 (6): 763-771. doi: 10.1093/jac/47.6.763.
Briñas, l.; Zarazaga, M.; Sãenz, Y.; Ruiz-Larrea, F. and Torres, C. (2002): β -Lactamases in Ampicillin-Resistant Escherichia coli Isolates from Foods, Humans, and Healthy Animals. Antimicrobial Agent and Chemotherapy, p. 3156–3163. Vol. 46, No. 10.
Bush, K.; Jacoby, G.A. and Medeiros, A.A. (1995): A functional classification scheme for beta-lactamases and its correlation with molecular structures. Antimicrob. Agents Chemother. 39: 1211–1233.
Cattoir, V.; Poirel, L. and Nordmann, P. (2008): Plasmid-mediated quinolone resistance pump QepA2 in an Escherichia coli isolate from France. Antimicrob Agents Chemother 52: 3801-3804.
Cavaco, L.M.; Hasman, H.; Xia, S. and Aarestrup, F.M. (2009): QnrD, a novel gene conferring transferable quinolone resistance in Salmonella enterica serovar Kentucky and Bovismorbifican strains of human origin. Antimicrob. Agents Ch., 53: 603–608.
Chen, X.; Zhang, W.; Pan, W.; Yin, J.; Pan, Z.; Gao, S. and Jiao, X. (2012): Prevalence of qnr, aac (6′)-Ib-cr, qepA, and oqxAB in Escherichia coli Isolates from Humans, Animals, and the Environment. Antimicrobial Agents and Chemotherapy p. 3423–3427. Volume 56 Number 6.
Colom, K.; Pèrez, J.; Alonso, R.; Fernández-Aranguiz, A.; Lariňo, E. and Cisterna, R. (2003): Simple and reliable multiplex PCR assay for detection of blaTEM, blaSHV and blaOXA-1 genes in Enterobacteriaceae. FEMS Microbiology Letters 223 (2003) 147-151.
El-Jakee, J.K.; Mahmoud, R.M.; Samy, A.A.; El-Shabrawy, M.A.; Effat, M.M. and Gad El-Said, W.A. (2012):Molecular Characterization of E. coli Isolated from Chicken, Cattle and Buffaloes. International Journal of Microbiological Research 3 (1): 64-74.
Ewers, C.; Janssen, T.; Kiessling, S.; Philipp, H.C. and Wieler, L.H. (2004):Molecular epidemiology of avian pathogenic Escherichia coli (APEC) isolated from colisepticemia in poultry. Veterinary Microbiology, 104,        91-101.
Fàbrega, A.; Madurga, S.; Giralt, E.; Vila, J. (2009): Mechanism of action of and resistance to quinolones. Microb Biotechnol 2: 40-61.
Galani, I.; Kontopidou, F.; Souli, M.; Rekatsina, P.D.; Koratzanis, E.; Deliolanis, J. and Giamarellou, H. (2008): Colistin susceptibility testing by Etest and disk diffusion methods. Int J. Antimicrob Agents. 2008 May; 31(5): 434-9.
Ghanbarpour, R. and Oswald, E. (2010): Phylogenetic Distribution of Virulence Genes in Escherichia coli Isolated from Bovine Mastitis in Iran. Res. Vet. Sci., 88, 6-10.
Ghosh, S.S. (1988): E. coli serotypes of poultry in Nagaland. Indian J. Animal Res., 22:35-38.
Guerra, B.; Junker, E.; Schroeter, A.; Malorny, B.; Lehmann, S. and Helmuth, R. (2003): Phenotypic and genotypic characterization of antimicrobial resistance in German Escherichia coli isolates from cattle, swine and poultry. J. Antimicrob Chemother. 2003 Sep; 52 (3): 489-92.
Hasan, B.; Faruque, R.; Drobni, M.; Waldenström, J.; Sadique, A.; Ahmed, K.U.; Islam, Z.; Parvez, M.B.; Olsen, B. and Alam, M. (2011): High prevalence of antibiotic resistance in pathogenic Escherichia coli from large- and small-scale poultry farms in Bangladesh. Avian Dis. 2011 Dec; 55(4):689-92.
Holmberg, S.D.; Osterman, M.T. and Senger, K.A. (1984): Drug resistant E. coli from animal fed antimicrobial, New England J. Medicine, 311: 617-622.
Hooper, DC. (2001): Emerging mechanisms of fluoroquinolone resistance. Emerg. Infect. Dis. 7: 337–341.
Ionica FODOR (2011): Antimicrobial Susceptibility of E. coli Strains Isolated from a Colisepticemia Outbreak in Broilers. Bulletin UASVM, Veterinary Medicine 68(2)/2011.
Janben, T.; Schwarz, C.; Preikschat, P.; Voss, M.; Philipp, H.C. and Wieler, L.H. (2001): Virulence-associated genes in avian pathogenic Escherichia coli (APEC) isolated from internal organs of poultry having died from colibacillosis. International Journal of Medical Microbiology, 291, 371-378.
Jiang, H.X.; Lü, D.H.; Chen, Z.L.; Wang, X.M.; Chen, J.R.; Liu, Y.H.; Liao, X.P.; Liu, J.H. and Zeng, ZL. (2009): High prevalence and widespread distribution of multi-resistant Escherichia coli isolates in pigs and poultry in China. Vet J. 2011 Jan; 187(1): 99-103. doi: 10.1016/j.tvjl.2009.10.017.
Johnson, J.R.; Kuskowski, M.A.; Smith, K.; O'Bryan, TT. and Tatini, S. (2005): Antimicrobial-resistant and extraintestinal pathogenic Escherichia coli in retail foods. J Infect Dis. 2005 Apr 1; 191(7):1040-9.
Johnson, J.R.; Murray, A.C.; Gajewski, A.; Sullivan, M.; Snippes, P.; Kuskowski, M.A. and Smith, K.E. (2003): Isolation and molecular characterization of nalidixic acid-resistant extraintestinal pathogenic Escherichia coli from retail chicken products. Antimicrob Agents Chemother. 2003 Jul; 47(7):2161-8.
Johnson, T.J.; Siek, KE.; Johnson, SJ. and Nolan, LK. (2006): DNA sequence of a ColV plasmid and prevalence of selected plasmid-encoded virulence genes among avian Escherichia coli strains. Journal of Bacteriology, 188, 745-758.
Kobayashi, H.; Kanazaki, M.; Hata, E. and Kubo, M. (2009): Prevalence and Characteristics of eae- and stx-Positive Strains of Escherichia coli from Wild Birds in the Immediate Environment of Tokyo Bay. Applied and Environmental Microbiology, p. 292–295. Vol. 75, No. 1.
Krause, G.; Zimmermann, S. and Beutin, L. (2005): Investigation of domestic animals and pets as a reservoir for intimin-(eae) gene positive Escherichia coli types. Veterinary Microbiology, 106, 87-95.
Kreig N.R.; J.G. Holt; Williams and Wilkins, (1984): Bergeys Manual of Systematic Bacteriol.,1:428, East Preston street, Baltimor, M.D.21202, USA.
Krishnamohan Reddy, Y. and Koteeswaran, A. (1994): Studies on experimental E. coli infection in Japanese quail. Indian Veterinary J., 71:959-963.
Kuo, H.C.; Chou, C.C.; Tu, C.; Gong, S.R.; Han, C.L.; Liao, J.W. and Chang, S.K. (2009): Characterization of plasmid-mediated quinolone resistance by the qnrS gene in Escherichia coli isolated from healthy chickens and pigs. Veterinarni Medicina, 54, 2009 (10): 473–482.
Li, X.S.Wang, G.Q.Du, X.D.; Cui, B.A.; Zhang, S.M. and Shen, J.Z. (2007): Antimicrobial susceptibility and molecular detection of chloramphenicol and florfenicol resistance among Escherichia coli isolates from diseased chickens. J. Vet. Sci. 2007 Sep; 8(3): 243-7.
Literak, I.; Reitschmied, T.; Bujnakova, D.; Dolejska, M.; Cizek, A.; Bardon, J.; Pokludova, L.; Alexa, P.; Halova, D. and Jamborova, I. (2013): Broilers as a Source of Quinolone-Resistant and Extraintestinal Pathogenic Escherichia coli in the Czech Republic. Microb Drug Resist. 2013 Feb; 19(1):57-63. doi: 10.1089/mdr.2012.0124.
Livermore, DM. (1995):β -Lactamases in laboratory and clinical resistance. Clin. Microbiol. Rev. 8:557–584.
Livermore, DM. (1998): Beta-lactamase-mediated resistance and opportunities for its control. J. Antimicrob. Agents 41(Suppl. D):25–41.
Lunn, A.D.; Fàbrega, A.; Sánchez-Céspedes, J. and Vila, J. (2010): Prevalence of mechanisms decreasing quinolone-susceptibility among Salmonella spp. clinical isolates. International Microbiology. 13:15-20.
Lyhs,  U.;  Ikonen,  I.;  Pohjanvirta, T.;  Raninen,  K.; Perko-Mäkelä, P. and Pelkonen, S. (2012): Extraintestinal pathogenic Escherichia coli in poultry meat products on the Finnish retail market. Acta. Vet. Scand. 2012 Nov 16;54:64. doi: 10.1186/1751-0147-54-64.
Mahmood Salehi and Reza Ghanbarpour (2010): Characterization of Escherichia coli Isolates from Commercial Layer Hens with Salpingitis. American Journal of Animal and Veterinary Sciences 5 (3): 208-214, 2010.
Manges, A.R. and Johnson, J.R. (2012): Food-Borne Origins of Escherichia coli Causing Extraintestinal Infections. Clin Infect Dis. 2012 Jun 7.
Mellata, M.; Dho-Moulin, M.; Dozois, C.M.; Curtiss, R.III.; Brown, P.K.; Arné, P.; Brée, A.; Desautels, C. and Fairbrother, JM. (2003): Role of virulence factors in resistance of avian pathogenic Escherichia coli to serum and in pathogenicity. Infection and Immunity, 71, 536-540.
MÜŞTAK, H.K.; ICA, T.; CIFTCI, A. and DİKER, K.S. (2012): Plasmid-mediated quinolone resistance in Escherichia coli strains isolated from animals in Turkey. Ankara Üniv. Vet. Fak Derg, 59, 255-258.
Oh, J.Y.; Kang, M.SAn, B.K.; Shin, E.GKim, M.J; Kim, Y.J. and Kwon, Y.K. (2012): Prevalence and characteristics of intimin-producing Escherichia coli strains isolated from healthy chickens in Korea. Poult Sci. 2012 Oct; 91(10):2438-43.
Okoli, C.I.; Chah, K.F.; Ozoh, P.T.E. and Udedibie, A.B.I. (2005): Anti Microbial Resistance Profile of E. coli isolates From Tropical Free Range Chickens. OJHAS: Vol 4, Issue3: (2005 Jul-Sep).
Persoons, D.; Dewulf, J.; Smet, A.; Herman, L.; Heyndrickx, M.; Martel, A.; Catry, B.; Butaye, P. and Haesebrouck, F. (2010): Prevalence and persistence of antimicrobial resistance in broiler indicator bacteria. Microb Drug Resist. 2010 Mar; 16(1): 67-74.
Robicsek, A.; Strahilevitz, J.; Sahm, D.F.; Jacoby, G.A. and Hooper, D.C. (2006): Qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob Agents Chemother 50: 2872-2874.
Rosario, C.C.; López, A.C.; Téllez, I.G.; Navarro, O.A.; Anderson, R.C. and Eslava, C.C. (2004): Serotyping and virulence genes detection in Escherichia coli isolated from fertile and infertile eggs, dead-in-shell embryos, and chickens with yolk sac infection. Avian Dis. 2004 Dec; 48(4):       791-802.
Saif, Y.M. and Colibacillosis, CH. (2003): Diseases of poultry, 18, (631-656)-11th ed.
Salehi T. Zahraei and Farashi Bonab, S. (2006): Antibiotics Susceptibility Pattern of Escherichia coli Strains Isolated from Chickens with Colisepticemia in Tabriz Province, Iran. International Journal of Poultry Science, 2006, vol 5: 677-684.
Sharada, R.; Wilfred Ruban, S. and Thiyageerswaran, M. (2010): Isolation, Characterization and Antibiotic Resistance Pattern of Echerichia coli Isolated from Pourltry. American –Eurasian Journal of Scientific Research 5(1): 18-22, 2010.
Stordeur, P.; China, B.; Charlier, G.; Roels, S. and Mainil, J. (2000): Clinical Signs, Reproduction of Attaching/Effacing Lessions, and Enterocyte Invasion after Oral Inoculation of an O118 Enterohaemorrhagic Escherichia coli in Neonatal Calves. Microbes and Infection. 2, 17-24.
Suardana, I.W.; Artama, W.T.; Asmara, W. and Daryono, B.S. (2011): Adherence Pheno-genotypic of Escherichia coli O157:H7 Isolated from Beef, Feces of Cattle, Chicken and Human. Indonesian Journal of Biotechnology. Vol. 16, No. 1, pp.46-52.
Thomson, K. and Moland, E.S. (2000): Version 2000: The new β-lactamases of gram-negative bacteria at the dawn of the new millennium. Microb. Infect. 2, 1225-1235.
Tran, J.H. and Jacoby, G.A. (2002): Mechanism of plasmid-mediated quinolone resistance. Proc Natl Acad Sci USA 99: 5638-5642.
Tricia D. MilesWayne McLaughlin and Paul D Brown (2006): Antimicrobial resistance of Escherichia coli isolates from broiler chickens and humans. Published online 2006 February 6. doi: 10.1186/1746-6148-2-7.
Wang, A.; Yang, Y.; Lu, Q; Wang, Y.; Chen, Y.; Deng, L.; Ding, H.; Deng, Q.; Zhang, H.; Wang, C.; Liu, L.; Xu, X.; Wang, L. and Shen, X. (2008): Presence of qnr gene in Escherichia coli and Klebsiella pneumoniae resistant to ciprofloxacin isolated from pediatric patients in China. BMC Infectious Diseases. 8:68.
Wang, X.M.; Liao, X.P.; Zhang, W.J.; Jiang, H.X.; Sun, J.; Zhang, M.J.; He, X.F.; Lao, D.X. and Liu, Y.H. (2010): Prevalence of serogroups, virulence genotypes, antimicrobial resistance, and phylogenetic background of avian pathogenic Escherichia coli in south of China. Foodborne Pathog Dis. 2010 Sep; 7 (9):1099-106. doi:10.1089/fpd.2010.0542.
Wen-jie, J.; Zhi-ming, Z.; Yong-zhi, Z.; Ai-jian, Q.; Hong-xia, S.; Yue-long, L.; Jiao, W. and Qian-qian, W. (2008): Distribution of Virulence-Associated Genes of Avian Pathogenic Escherichia coli Isolates in China. Agricultural Sciences in China, 7(12):      1511-1515.
Xia, X.; Meng, J.; Zhao, S.; Bodeis-Jones, S.; Gaines, S.A.; Ayers, S.L. and McDermott, P.F. (2011): Identification and antimicrobial resistance of extraintestinal pathogenic Escherichia coli from retail meats. J Food Prot. 2011 Jan; 74(1): 38-44.
Yaguchi, K.; Ogitani, T.; Osawa, R.; Kawano, M.; Kokumai, N.; Kaneshige, T.; Noro, T.; Masubuchi, K. and Shimizu, Y. (2007): Virulence factors of avian pathogenic Escherichia coli strains isolated from chickens with colisepticemia in Japan. Avian Diseases, 51, 656-662.
Yamane, K.; Wachino, J. and Suzuki, S. (2007): New plasmid-mediated fluoroquinolone efflux pump, QepA, found in an Escherichia coli clinical isolate. Antimicrob Agents Chemother 51: 3354-3360.
Yang, H.; Chen, S.; White, D.G.; Zhao, S.; McDermott, P.; Walker, R. and Meng, J. (2004): Characterization of multiple-antimicrobial-resistant Escherichia coli isolates from diseased chickens and swine in China. J. Clin Microbiol. 2004 Aug; 42(8): 3483-9.
Yu, J. and Kaper, J.B. (1992): Cloning and Characterization of The eae gene of Enterohaemorrhagic Escherichia coli O157:H7. Mol. Microbiol. 6, 411–417.
Yuan, L.; Liu, J.; Hu, G.; Pan, Y.; Liu, Z.; Mo, J. and Wei, Y. (2009): Molecular characterization of extended-spectrum β -lactamase-producing Escherichia coli isolates from chickens in Henan Province, China. Journal of Medical Microbiology, 58, 1449–1453.
Zhang, T.; Wang, C.G.; Jiang, G.E.; Lv, JC. and Zhong, XH. (2012)-(a): Molecular epidemiological survey on aminoglycoside antibiotics-resistant genotype and phenotype of avian Escherichia coli in North China. Poult Sci. 2012 Oct; 91(10): 2482-6.
Zhang, T.; Wang, C.G.; Lv, JC.; Wang, R.S. and  Zhong, X.H. (2012)-(b): Survey on tetracycline resistance and antibiotic-resistant genotype of avian Escherichia coli in North China. Poult Sci. 2012 Nov; 91(11): 2774-7. doi: 10.3382/ps.2012-02453.
Zhao, C.; Ge, B.; De Villena, J.; Sudler, R.; Yeh, E.; Zhao, S.; White, D.G.; Wagner, D. and Meng, J. (2001): Prevalence of Campylobacter spp., Escherichia coli, and Salmonella serovars in retail chicken, turkey, pork, and beef from the Greater Washington, D.C., area. Appl Environ Microbiol. 2001 Dec; 67(12):5431-6.
Zhao, S.; Maurer, J.J.; Hubert, S.; De Villena, J.F.; McDermott, P.F.; Meng, J.; Ayers, S.; English, L. and White D.G. (2005): Antimicrobial susceptibility and molecular characterization of avian pathogenic Escherichia coli isolates. Vet. Microbiol. 2005 May 20; 107(3-4): 215-24.