Authors
1 Researcher of Food Hygiene Unit, Animal Health Research Institute, Damanhur Branch, Egypt.
2 Senior Researcher of Biochemistry Unit, Animal Health Research Institute, Damanhur Branch, Egypt
3 Researcher of Food Hygiene Unit, Animal Health Research Institute, Damanhur Branch, Egypt
Abstract
Keywords
Assiut University web-site: www.aun.edu.eg
STUDY ON SOME ENTEROPATHOGENS OF STREET VENDED MEAT MEALS
SABER, A.S.1; HANAA, R. ELHOFY 2 and SALWA, A. HENDAWY 1
1 Researcher of Food Hygiene Unit, Animal Health Research Institute, Damanhur Branch, Egypt.
2 Senior Researcher of Biochemistry Unit, Animal Health Research Institute, Damanhur Branch, Egypt.
Received: 13 September 2017; Accepted: 17 October 2017
ABSTRACT
Sixty random samples of street vended meat meals including 20 samples each of Shawerma, Liver sandwich and Hawawshi were randomly collected from different street vendors at Damanhur city Elbehaira Governorate for chemical and microbiological evaluation. The results revealed that, the mean values of total volatile nitrogen (TVB-N), Thiobarbituric acid (TBA) and Aerobic Plate count (APC) were 27.8±0.48, 25.8±0.17, 27.6±0.41 mg/100gm; 0.71±0.02, 4.2±0.33, 0.73±0.01mgMD/kg and 7.5x104±0.85x104, 4.8x104±0.50x104, 4.5x104±0.48 x104cfu/g in the examined samples of Shawerma, liver sandwich and Hawawshi, respectively. Also, enterococci, enteropathogenic E.coli, Salmonella and Shigella were isolated with an incidence of 25, 20, 25 %; 30, 20, 25 %; 10, 15, 0 % and 15, 10,10% from the examined samples of Shawerma, liver sandwich and Hawawshi, respectively. Serotyping of the obtained isolates of enteropathogenic E. coli revealed the detection of O157: H7, O128: K67, O86: K61, O26: K60 and O26: K72 strains at varying rates, Stereotyping Salmonella isolates revealed the detection of S. Enteritidis, S. Typhi and S. Paratyphi. In addition to, biochemical identification of the obtained Shigella isolates revealed the detection of S. dysenteriae, S. flexneri and S. sonnei. Two strain of isolated E.coliO157:H7 and one salmonella isolates were investigated by using PCR to detect presence of virulent genes stx1 (614 bp) and stx2 (779 bp) in E.coli O157:H7 and stn. Gene (617 bp) in Salmonella. From previously mentioned results, enteric pathogens still constitute common contaminants of street vended meat meals and their presence was very important due to its public health significance therefore strict hygienic measures must be applied to obtain safe and wholesome street vended meat meals.
Key words: Meat meals, TVB-N, TBA, E.coli, O157:H7 Salmonella, Shigella.
|
INTRODUCTION
Street-vended meat meals are ready-to-eat (RTE) foods, excellent source of high quality protein, mineral and vitamins, prepared and sold by vendors on streets and public places. They provide a source of readily available, inexpensive and nutritional meals, while providing a source of income for the vendors (Swanepoel et al., 1998). Despite the economic and nutritional benefits of street foods, the consumption of these meat meals increase the risk of food borne diseases as these meals are readily contaminated from different sources (Tambekar et al., 2008).
In Egypt, the most ready-to-eat sandwiches sold in street vendors and fast food restaurants are Shawerma, liver sandwich and Hawawshi. Poor quality of raw materials, inadequate personnel hygiene of street vendor’s and holding for long period lead to contamination of street vended foods with pathogenic microorganism. Such contamination may
Corresponding author: Dr. HANNA, R. ELHOFY
E-mail address: ahmadbkheet@yahoo.com
Present address: Senior Researcher of Biochemistry Unit, Animal Health Research Institute, Damanhur Branch, Egypt.
render the product of inferior quality or unfit forhuman consumption (Gundogan et al., 2005).
TVB-N value was more useful for assessing the degree of meat deteri0ration than for evaluating the changes occurring during storage. TBA is agood indicator of the quality of meat products Its value used as indicator for degree of lipid oxidation in meat (Elshafay, 2014).
Unhygienic sanitary conditions in which street vended meat meals are prepared, stored and served raise the microbial load. High bacterial counts and a high incidence of foodborne pathogens in such foods have been reported many Researchers in different countries; (Khaitsa et al., 2007).
Salmonella is found worldwide and universally recognized as zoonotic agent. Many foods particularly of animal origin and those subjected to sewage pollution had been identified and must be taken into considerations as a vehicle for transmitting such pathogen to human being (ICMSF, 2006).
Most Pathogenic bacteria such as Escherichia Coli, salmonella species and Shigella have been implicated in a number of food borne illnesses and cause a variety of zoonotic infection in human and animals (Nouichi and Hamdi, 2009). E. coli has become recognized as a serious food borne pathogen and has been associated with numerous outbreaks of disease in the UK, Japan and USA (Scotter et al., 2000).
Escherichia coli O157:H7 is considered one of the most serious of known foodborne pathogens (Blanco et al., 2003). Escherichia coli O157:H7 strain produces shiga toxin 1 (stx-1) and shiga toxin 2 (stx-2) which are also referred as verotoxins. Escherichia coli O157:H7 strains carrying stx genes along with enterohaemolysin (hlyA) and intimin (eae) genes are potentially dangerous to human health (Manna et al., 2006).
Shiga toxins and intimin are key virulence factors for the pathogenesis of Escherichia coli O157 and other Enteropathogenic E.coli (EPEC) strains (Gyles, 2007). Shiga toxin–producing Escherichia coli (STEC) have emerged as important enteric food born zoonotic pathogens of considerable public health significance in Egypt (Ahmed and Shimamoto, 2015) and worldwide (Brooks et al., 2005). STEC comprise a diverse group that elaborate one or both Shiga toxins (stx1 and stx2) and can cause diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome in human beings (Grant et al., 2011). Both STEC O157 and non-O157 are bacteria that cause serious human disease outbreaks through the consumption of contaminated food products (Gyles, 2007), but most of these STEC infections are caused by E. coli O157:H7 (20–70%) throughout the world are attributed to E. coli of non-O157 (Brooks et al., 2005).
Presence of specific microorganisms such as E.coli, Salmonella and Shigella in foods served by the street vendors is an indicative of a degree of ignorance on the part of the handlers towards proper hygienic practices (Lues et al., 2006). Also the major sources contributing to microbial contamination are the place of preparation, utensils for cooking and serving, raw materials, time and temperature abuse of cooked foods and the personal hygiene of vendors (Rane- Sharmila, 2011).
The virulence of Salmonella is linked to a combination of chromosomal and plasmid factors. Different genes such as inv, spv, fimA and stn have been identified as major virulence genes responsible for salmonellosis (Darwin and Miller, 1999). The enterotoxin production gene is mediated by the stn thus it plays a significant role in causing gastroenteritis by producing enterotoxin (Chopra et al., 1987).
In Egypt, there is lack of information about the incidence of food-borne diseases and problems related to consumption of street vended meat meals. Therefore, the aim of the present study was to evaluated street vended meat meals (Shawerma, Liver sandwich and Hawawshi) chemically through determination of Total Volatile Nitrogen (TVB-N) and Thiobarbituric acid (TBA), bacteriologically through determination the incidence of enterococci, Enteropathogenic Escherichia coli and Salmonella and Shigella species in these meals and serotyping of isolated E.coli, salmonella and Shigella strains. Also, using PCR technique for detection of virulence gene in Salmonella isolates (Stn gene) and Stx2 gene in E.coli isolates.
MATERIALS AND METHODS
2.1. Collection of samples:
A total of 60 random samples of street vended meat and liver meals including; Shawerma, Hawawshi, and Liver sandwich (20 samples of each) were collected from different street vendors at Damanhour city. Samples were kept in a separate sterile plastic bag and transferred in an ice box as soon as to the laboratory of the Food Control Department, inanimal health research institute under possible aseptic conditions. The samples were subjected to the following examinations:
2.2. Determination of chemical parameters:
2.3. Preparation of samples for bacteriological examination (ICMSF, 1996):
Twenty-five grams of each sample were aseptically transferred into sterile blender flask containing 225 ml of sterile peptone water 1% and homogenized at 14000 rpm for 2.5 minutes.
2.4. Bacteriological examination:
2.5. PCR techniques:
The products of PCR were separated by electrophoresis on 1.5% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature using gradients of 5V/cm. For gel analysis, 20 µl of each PCR product were loaded in each gel slot. A gene ruler 100 bp DNA Ladder (Fermentas, Germany) were used to determine the fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra) and the data was analyzed through computer software.
Table A: Primers sequences, target genes, amplicon sizes and cycling conditions.
Target gene |
Primers sequences |
Amplified segment (bp) |
Primary denaturation |
Amplification (35 cycles) |
Final extension |
Reference |
||
Secondary denaturation |
Annealing |
Extension |
||||||
stn |
TTG TGT CGC TAT CAC TGG CAA CC |
617 |
94˚C 5 min. |
94˚C 30 sec. |
58˚C 45 sec. |
72˚C 45 sec. |
72˚C 10 min. |
Murugkar et al., 2003 |
ATT CGT AAC CCG CTC TCG TCC |
||||||||
Stx1
|
5′ ACACTGGATGATCTCAGTGG ′3 |
614 |
94˚C 5 min. |
94˚C 30 sec. |
58˚C 45 sec. |
72˚C 45 sec. |
72˚C 10 min. |
Dhanashree and Mallya (2008) |
5′ CTGAATCCCCCTCCATTATG ′3 |
||||||||
Stx2 |
5′ CCATGACAACGGACAGCAGTT ′3 |
779 |
94˚C 5 min. |
94˚C 30 sec. |
58˚C 45 sec. |
72˚C 45 sec. |
72˚C 10 min. |
Dhanashree and Mallya (2008) |
5′ CCTGTCAACTGAGCAGCACTTTG ′3 |
RESULTS
Table 1: Statistical analytical results of total volatile nitrogen (TVB-N) mg/100 gm in examined samples of street vended meat meals.
Products |
Min |
Max |
X ±SEM |
Shawerma |
25.48 |
30.80 |
27.8±0.48 |
Liver Sandwich |
24.75 |
26.60 |
25.8±0.17 |
Hawawshi |
25.00 |
30.30 |
27.6±0.41 |
Minimum=MinMaximum=MaxMean= XStandarderror =SEM
Table 2: Statistical analytical results of thiobarbituric acid (TBA) mgMD/kg in examined samples of street vended meat meals.
Products |
Min |
Max |
X ±SEM |
Shawerma |
0.616 |
.827 |
0.71±0.02 |
Liver Sandwich |
2.62 |
6.07 |
4.2±0.33 |
Hawawshi |
0.600 |
.835 |
0.73±0.01 |
Minimum= Min Maximum=Max Mean = X Standard error = SEM
Table 3: Statistical analytical results of aerobic plate count in examined samples of street vended meat meals.
Products |
Min |
Max |
X ±SEM |
Shawerma |
1.3x104 |
1.5x105 |
7.5x104±0.85x104 |
Liver Sandwich |
1.6x104 |
9.5x104 |
4.8x104±0.50x104 |
Hawawshi |
1.2x104 |
8.0x104 |
4.5x104±0.48x104 |
Minimum = Min Maximum= Max Mean= X Standard error = SEM
Table 4: Incidence of isolated enterococci in examined samples of street vended meat meals.
Products |
No. of examined samples |
Positive samples |
|
NO. |
Percent (%) |
||
Shawerma |
20 |
5 |
25 |
Liver Sandwich |
20 |
4 |
20 |
Hawawshi |
20 |
5 |
25 |
Table 5: Incidence of enteropathogenic E.coli in examined samples of street vended meat meals.
Products |
No. of examined samples |
Positive samples |
|
NO. |
Percent (%) |
||
Shawerma |
20 |
6 |
30 |
Liver Sandwich |
20 |
4 |
20 |
Hawawshi |
20 |
5 |
25 |
Table 6: Serotyping of enteropathogenic E.coli isolated from examined samples of street vended meatmeals.
Products |
Shawerma |
Liver Sandwich |
Hawawshi |
|||
Strains |
NO |
% |
NO |
% |
NO |
% |
O157:H7 |
1 |
5 |
0 |
0 |
1 |
5 |
O128: K67 |
2 |
10 |
2 |
10 |
1 |
5 |
O86: K61 |
0 |
0 |
1 |
5 |
1 |
5 |
O26: K60 |
1 |
5 |
1 |
5 |
2 |
10 |
O26: K72 |
2 |
10 |
0 |
0 |
0 |
0 |
Total |
6 |
30 |
4 |
20 |
5 |
25 |
Table 7: Incidence of Salmonella in examined samples of street vended meat meals.
Products |
No. of examined samples |
Positive samples |
|
NO. |
Percent (%) |
||
Shawerma |
20 |
2 |
10 |
Liver Sandwich |
20 |
3 |
15 |
Hawawshi |
20 |
0 |
0 |
Table 8: Serotyping of Salmonella species isolated from examined samples of street vended meat meals.
Products |
Shawerma |
Liver Sandwich |
Hawawshi |
|||
Strains |
NO |
% |
NO |
% |
NO |
% |
S. enteritidis |
1 |
5 |
1 |
5 |
0 |
0 |
S. typhi |
1 |
5 |
1 |
5 |
0 |
0 |
S. paratyphi |
0 |
0 |
1 |
5 |
0 |
0 |
Total |
2 |
10 |
3 |
15 |
0 |
0 |
Table 9: Incidence of Shigella in examined samples of street vended meat meals.
Products |
No. of examined samples |
Positive samples |
|
NO. |
Percent (%) |
||
Shawerma |
20 |
3 |
15 |
Liver Sandwich |
20 |
2 |
10 |
Hawawshi |
20 |
2 |
10 |
Table 10: Sero-typing of Shigella species isolated from examined samples of street vended meat meals.
Products |
Shawerma |
Liver Sandwich |
Hawawshi |
|||
Strains |
NO |
% |
NO |
% |
NO |
% |
S. dysenteriae |
1 |
5 |
1 |
5 |
0 |
0 |
S. Flexneri |
1 |
5 |
1 |
5 |
1 |
5 |
S. Sonni |
1 |
5 |
0 |
0 |
1 |
5 |
Total |
3 |
15 |
2 |
10 |
2 |
10 |
Fig. (1): Agarose gel showing polymerase chain reaction amplification products of stn gene (617 bp) in one Salmonella isolates, L:00 bp ladder as molecular size DNA marker, pos: control positive for shiga toxins 1 (stx1) and shiga toxin 2(stx2), Neg: control negative lane 1: positive strain for stn gene (617 bp).
Fig. (2): Agarose gel showing polymerase chain reaction amplification products of stx1 (614 bp) and stx2gene (779 bp) in two E.coli O157:H7 strain, L:00 bp ladder as molecular size DNA marker, pos: control positive for shiga toxins 1 (stx1) and shiga toxin 2(stx2), Neg: control negative for stx1 and stx2, lane 15: positive strain for stx1, lane 16: positive strain for stx2.
DISCUSSION
TVB-N value was more useful for assessing the degree of meat deterioration than for evaluating the changes occurring during the first storage stages (El-Marrakchi et al., 1990).
Presented data in Table (1) revealed that TVB-Nmean values in the examined Shawerma, liver sandwich and Hawawshi were 27.8±0.48, 25.8±0.17 and 27.6±0.41, respectively. The present data in Table (1) showed that, all examined Shawerma, and Hawawshi were higher than the permissible limit according to EOS, (2005) for TVN in red meat, should not exceed (20 mg/ 100 gm). Examined liver samples were within permissible limits according to EOS, (2005) for TVN in edible offal (should not exceed 30 mg / 100 gm).
Ibrahim et al. (2013) they reported that mean values of TVB-N of 30 liver samples collected from two traditional abattoirs of Elbehira province was 13.06 ± 0.04.
Metabolization of meat s low molecular substances, such as sugar and free amino acids and the release of undesirable volatile metabolites. As soon as the glucose present in aqueous phase has been exhausted other substrates are consequently utilized by metabolizing microorganisms to produce odoriferous nitrogenous compounds, the most predominant of which is ammonia (Stanbridge and Davis, 1998). Microbial loads from 10 7cfu /cm-2 have been associated with occurrence of off-odors when the loads increased to as high as 109cfu/cm-2 when the meat becomes putrid (Jay, 2000).
TBA is a good indicator of the quality of meat. TBA value is a widely used indicator for the assessment of degree of lipid oxidation (Raharjo and Sofos, 1993). Moreover, Kautsoumanis et al. (2008) Stated that lipid oxidation is a complex process whereby, unsaturated fatty acid react with molecular oxygen leading to degradation of lipids and development of oxidative rancidity
Results achieved in Table (2) revealed that (TBA mg malonaldehyde/kg of sample) mean values in examined Shawerma, liver sandwich and Hawawshi were 0.71±0.02, 4.2±0.33 and 0.73±0.01, respectively. These results showed that, all examined samples Shawerma, and Hawawshi were within the permissible limit according to EOS, (2005) which stated that the maximum permissible limit for (TBA) in meat and edible offal should not exceed 0.9 mg malonaldehyde / kg of sample. The examined samples of liver were higher than the permissible limit for TBA according to EOS, (2005) that could be attributed to the use rancid oil in preparation of liver for sandwich.
Ibrahim et al. (2013) they reported that mean values of TBA of 30 liver samples collected from two traditional abattoirs of Elbehira province was 0.16 ± 0.01.
Microbiological quality problems of street vended meat meals depend greatly on low initial quality of raw materials and other ingredients, insufficient cooking process and improper sanitary practices for personal and for cooking/processing utensils (Kayaardi et al., 2006). Even though their ingredients reach a temperature that is ideal to ensure that the food is cooked thoroughly, cross contamination during preparation of these meals could be traced back to the use of uncooked green vegetables and unhygienic handling (Reij and Aantrekker, 2004).
The obtained results presented in Table (3) revealed that aerobic plate count of Shawerma, liver sandwich and Hawawshi ranged from 1.3×104 to 1.5 ×105, 1.6×104 to 9.5 ×104 and 1.2×104 to 8.0 ×104 with an average count 7.5x104±0.85x104, 4.8x104±0.50x104 and 4.5x104±0.48x104cfu/g, respectively. APC is tended to indicate the level of microorganisms in products (FDA, 2001).
The present results nearby results obtained by (Mohammed et al., 2004) they reported that mean values for aerobic plate count of Shawerma, liver, and El-Hawawshi sandwiches were 29x103 ±4.9x103, 27x103±1.8x103, and 20x104±2.6x104cfu/g, respectively. Also, similar to El Zekaty et al. (2016) they reported that mean values of APC of Hawawshi, liver sandwiches and Shawerma were 8.9×105± 1.1×105, 5.2×105±1.3×105 and 5.4×105±1.2×105cfu/g, respectively.
Higher finding of APC were recorded by (Abou, 1995 and Mohamed, 2001) in Alexandria and Assiutcity where microbial investigation of 30 samples of roasted liver sandwich revealed that the average counts was 8 ×106cfu/g in Alexandria city and 4×107cfu/gin a related study in Assiut city. On the other hand, Mohamed et al. (2004) and El- Mossalami et al. (2008) found lower incidence of APC of liver sandwiches in another research in Assiut and Alexandria city.
Dalia et al. (2013) they reported that the log count of aerobic plate count in all liver sandwich samples ranged from 3.73 to 5.99.
The data presented in Table (4) showed that the incidence of enterococci in the examined samples of Shawerma, Liver sandwich and Hawawshi was 25, 20 and 25 %, respectively.
The recorded data in Table (5) illustrated that the incidence of enteropathogenic E.coli in the examined samples of Shawerma, Liver sandwich and Hawawshi was 30, 20 and 25 %, respectively.
Our finding agreed with (Emara et al., 2016) they reported that the incidence of E.coli in examined Shawerma, Liver sandwich, Hawawshi (50 samples of each) was 30, 20 and 26 %. higher result recorded by Hiko A et al. (2008), Rahimi et al. (2012) and Jacob et al. (2013) while, lower finding recorded by Ahmad et al. (2013).
Heating food at high temperature 51ºC decrease the survival of E. coli cells after 10 min. and no colonies were observed after heating for 180 minute, viable E. coli were not found after at 53 ºC for 60 min (Nakano et al., 2012).
The recorded data in Table (6) illustrated that serotyping of the obtained isolates of enteropathogenic E. coli revealed the detection of O157: H7 strain at the rate of 5, 0 and 0%, O128: k67 strain at the rate of 10, 10 and 5%, O86: K61 strain at the rate of 0, 5 and 5%, O26: K60 strain at the rate of 5, 5 and 10%, O26: K72 strain at the rate of 10, 0 and 0% from the examined samples of Shawerma, Liver sandwich and Hawawshi, respectively.
Our findings agree with Emara et al. (2016) they could isolate enteropathogenic E. coli and serotyped, they found that the detection rate of O26: K60 (B6) strain were 4, 6 and 2 %; O128: K67 (B12) strain at the rate of 4, 2 and 4 %; O86: K61 (B7) strain at the rate of 4, 4 and 6 % and O157: H7 strain at the rate of 4, 4 and 6 % from the examined samples of Shawerma, Liver sandwich and Hawawshi, respectively.
E. coli O157 more serious strain of E.coli isolates, so detection of E. coli O157:H7 and other Shiga toxin-producing E. coli (STEC) in ready-to-eat food possesses a public health hazards (EFSA, 2014).
As shown in Fig (2) both Shiga toxin stx1 and stx 2 genotypes occurred among two STEC O157 strains isolated from Shawerma and Hawawshi.
Detection of E. coli O157 and other verocytotoxin producing E. coli (VTEC) in different meat sources considered a high microbiological Risk, potentially injurious to health and / or unfit for human consumption (European Commission, 2002).
Shiga toxin (stx) producing E. coli (STEC) contamination in food is one of the most recognized concerns and a major financial burden in human hygiene control worldwide. Rapid and highly reliable methods of detecting and identifying STEC causing gastroenteric illnesses are crucial to prevent food borne outbreaks. In order to screen pathogenic STEC without relying on O:H serotyping, we developed a rapid detection and genotyping assay for STEC virulence genes using a PCR for detection of major virulence genes, Shiga toxin 1 and 2 (stx1 and stx2), intimin (eae) (Goji et al., 2015).
Shiga toxin-producing Escherichia coli (STEC), encompassing E. coli O157 and non-O157 STEC, are a significant cause of food-borne illnesses and deaths in the United States and worldwide. Shiga toxins (encoded by stx1 and 2) are important virulence factors for STEC strains linked to severe human illnesses (Fei et al., 2012). These groups are important for determining potential pathogens, the presence of virulence attributes, such as stx1 and stx2 are important parameters for pathogenicity of the strains (Johnson et al., 1996).
Salmonella is worldwide foodborne illness transmitted to human through food of animal origin, sodetection of Salmonella species in different street vended meat meals was considered a high microbiological risk, potentially injurious to health and/ or unfit for human consumption (European Commission, 2002). Salmonella must be absent in relevant products when placed on the market, during their shelf-life (European Commission, 2005).
The recorded data in Table (7) illustrated that the incidence of Salmonella in the examined samples of Shawerma and Liver sandwich was 10 and15 %, while, Salmonella cloud not be detected from Hawawshi. Presence of street vended meat meals objectionable and indicated high microbiological risk, so Salmonella must be absent in these food (European Commission, 2005). In addition, the obtained results in Table (8) showed that the serotyping of Salmonella isolates revealed detection of Salmonella enteritidis at rate of 5,5 and 0 %, and Salmonella typhi at rate of 5, 5 and 5%.
The results of present study nearby the results obtained by Emara et al. (2016) they could isolate S. Enteritidis strain at the incidence rate of 2 and 2 % from the examined samples of Shawerma and Liver sandwich, respectively; detect S. Typhi strain at the incidence rate of 2 and 4 % from the examined samples of Shawerma and Liver sandwich, respectively and S. Paratyphi failed to be detected in Hawawshi samples.
The present data revealed that incidence of Salmonella in liver sandwich was 15 %, these finding agree with Abd El-Malek (2014) while, disagree with Büyükyörük et al. (2014) and Salma et al. (2015) where Salmonella failed to be isolated from cooked liver sandwiches, while disagreed with Salmonella causing food poisoning infection, most common symptoms of Salmonellosis were diarrhea, abdominal cramps and fever within 8 to 72 hours. Other symptoms including fever, headache, nausea and vomiting that can last up to 7 days (FSIS, 2008).
As shown in Fig (1) showing that one salmonella isolate produced 617 bp DNA fragment specific for stn gene which responsible for virulence. Thus, this Salmonella isolate was found highly invasive and enterotoxigenic.
The recorded data in Table (9) illustrated that the overall incidence of Shigella in the examined samples of street vended meat meals in the current study was 35 % and the incidence of Shigella in the examined samples of Shawerma, Liver sandwich and Hawawshi was 10, 10 and 15 %, respectively. The obtained results recorded in examined samples were higher than that recorded by Ali et al. (2010). On contrary, Dabassa and Bacha, (2012) detected no Shigella on examined meat samples. Detection of Shigella spp. in ready-to-eat food possesses apublic health hazards (EFSA, 2014).
Detection of Shigella was considered a high microbiological risk. Potentially injurious to health and /or unfit for human consumption were recorded (European Commission, 2002).
Moreover, the recorded data in Table (10) clarified that biochemical identification of the obtained isolates of Shigella species from the examined samples of street vended meat meals revealed detection of S. dysenteriae at the rate of 5, 5 and 0%; S. flexneri at the rate of 5, 5 and 5% and S. sonnei at the rate of 5, 0 and 5 % from the examined samples of Shawerma, Liver sandwich and Hawawshi, respectively.
Our finding agrees with Emara et al. (2016) they could have isolated Shigella from examined street vended meat meals at incidence rate 10%, also, they found after biochemical identification of isolated Shigella strains that S. dysenteriae isolated at incidence rate of 4, 6 and 4 %; S. flexneri at incidence rate of 4, 2 and 2 % and S. sonnei at incidence rate of 2, 4 and 2% from the examined samples of Shawerma, Liver sandwich, and Hawawshi, respectively.
Results of the present study revealed that incidence of Shigella in liver sandwich was 10 %, lower incidence of Shigella obtained by Salma et al. (2015) demonstrate that incidence of Shigella was 1(3%) in cooked liver sandwiches. While, higher incidence of Shigella obtained by Abd El-Malek (2014) who could detect Shigella in 23% of liver sandwich (kebda) samples.
Presence of Shigella in street vended meat meals indicate a human fecal contamination due to Shigella transmission by the fecal-oral route, including direct person-to-person contact and may be indirect through ingestion of contaminated food or water (Jomezadeh, 2014), so it is most likely to occur in children and those who neglect to clean hands thoroughly.
CONCLUSION AND RECOMMENDATION
From the results it be concluded that street vended meat meals in Damanhur city constitutes a likely potential hazard to human health. The presence of enterococci, enteropathogenic E. coli, salmonella and Shigella in these mealsindicates fecal contamination, so consumption of these meals cause possible risk of infection. Using of high quality raw materials, efficient heat treatment, adequate cleaning and sanitization of utensils may assist reducing this contamination, training of all food handlers and implement a hazard analysis may lead to an improvement in hygienic, finally the policy makers should address legislations for street-vendors to assure their personal hygiene and sanitation.
REFERENCES
Abd El-Malek, A.M. (2014): Microbiological quality of Ready to Eat liver sandwiches (Kebda). Global Veterinaria, 13(6): 1097-1102.
Abou, E.A. (1995): Bacteriological quality of ready to eat meals. J. Egypt Public Health Assoc., 70: 627-41.
Ahmad, M.U.D.; Sarwar, A.; Najeeb, M.I.; Nawaz, M.; Anjum, A.A.; Ali, M.A. and Mansur, N. (2013): Assessment of Microbial Load of Raw Meat at Abattoirs and Retail Outlets. Journal of Animal and Plant Sciences, 23(3): 745-748.
Ahmed, A.M. and Shimamoto, T. (2015): Molecular analysis of multidrug resistance in Shiga toxin-producing Escherichia coli O157:H7 isolated from meat and dairy products. Int. J. Food. Microbiol. 193:68-73.
Ali, N.H.; Farooqui, A.; Khan, A.; Khan, A.Y. and Kazmi, S.U. (2010): Microbial contamination of raw meat and its environment in retail shops in Karachi, Pakistan. The Journal of Infection in Developing Countries, 4(06): 382-388.
Blanco, M.; Blanco, J.E.; Mora, A.; Rey, J.; Alonso, J.M.; Hermoso, M.; Hermoso, J.; Alonso, M.P.; Dahbi, G.; González, E.A.; Bernárdez, M.I. and Blanco, J. (2003): Serotypes, virulence genes and intimin types of shiga toxin (verotoxin)-producing Escherichia coli isolates from healthy sheep in Spain. J. Clin. Microbiol., 41: 1351-1356.
Brooks, J.T.; Sowers, E.G. and Wells, J.G. (2005): Non-O157 Shiga toxin-producing Escherichia coli infections in the United States, 1983–2002. J. Infect Dis. 192:1422–1429.
Büyükyörük, S.; Devrim, B.; Ergun, Ö.G.; Filiz, K. and Pelin, K. (2014): Microbiological evaluation of ready-to-eat sandwiches served near hospitals and schools. Academic Journal of Ankara Üniversitesi Veteriner Fakultesi Dergisi, 61(3): 193-198.
Chopra, A.K.; Houston, C.W.; Peterson, J.W.; Prasad, R. and Mekalanos, J.J. (1987): Cloning and expression of the salmonella enterotoxin gene. J. Bacteriol., 169(11) 5095-5100.
Dabassa, A. and Bacha, K. (2012): The Prevalence and Antibiogram of Salmonella and Shigella Isolated from abattoir, Jimma town, South West, Ethiopia. International Journal of Pharmaceutical and Biological Research, 143-148.
Dalia F. khater; Gamal E. Heikal; Amal A. Shehata and Fatma I. El-Hofy (2013): The microbiological assessment of ready-to-eat-food (liver and kofta sandwiches) in Tanta city, Egypt. Benha Veterinary Medical Journal, vol. 25, no. 2:187-197,
Darwin, K.H. and Miller, V.L. (1999): Molecular basis of the interaction of Salmonella with the intestinal mucosa. Clin. Microbiol. Rev., 12(3): 405-428.
Dhanashree, B. and Mallya, S. (2008): Detection of shigatoxigenic Escherichia coli (STEC) in diarrhoeagenic stool and meat samples in Mangalore, India. Indian J. Med. Res., 128: 271-277.
EFSA (European Food Safety Authority) (2014): Scientific Opinion on the public health risks related to the maintenance of the cold chain during storage and transport of meat. Part 1 (meat of domestic ungulates). EFSA Journal 2014, 12(3): 3601.
El Marrakchi, A.; Bennour, M.; Bouchriti, N.; Hamama, A. and Tagafait, H. (1990): Sensory, Chemical and Microbiological assessment of Moroccan sardines (Sardinapilchardus) stored in ice. J. Food Prot., 53: 0–5.
Elshafay, M.S. (2014): Food safety of cattle meat and offal at abattoir level M.vsc. Vet. Med. Sci. Food control Dept. Meat hyaline Benha Univ.
El Zekaty, Anas, Mohammad A. Nossair, Ibrahim A. Samaha and Eman Khalifa (2016): Microbial Evaluation of Selected Ready to Eat Street Vended Meat Products Sandwiches with Emphasis on Public Health Importance of E.coli Isolates. AJVS. Vol. 51(2): 27-32.
El-Mossalami, H.A.; Abd-El-Rahman, A.A. and Magdy, E.M. (2008): A study on the effect of garlic and nigella sativa on some food poisoning bacteria isolated from ready-to-eat meat sandwiches in Alexandria City. Assiut Vet. J., 54: 119.
Emara, A.; Ibrahim, S.; Yaser, H. and Mohammad, N. (2016): Contamination of street vended meat meals by some enteropathogens. Alexandria Journal of Veterinary Sciences.
EOS (2005): Egyptian Organization for Standardization and Quality control No. 1522 for frozen meat.
EOS (2005): Egyptian Organization for Standardization and Quality control No. 1473 for frozen liver.
European Commission (EC) (2002): Regulation (EC) No 178/2002 of the European Parliament and of the Council of 28 January 2002 laying down the general principles and requirements of food law, establishing the European Food Safety Authority and laying down procedures in matters of food safety. Official Journal L 031, 01/02/2002 P. 0001 –0024.
European Commission (EC) (2005): Regulation (EC) No 2073/2005 of 15 November 2005 on microbiological criteria for foodstuffs. Official Journal of the European Union, p. L 338/1- L 338/26.
European Commission (EC) (2005): Regulation (EC) No 2073/2005 of 15 November 2005 on microbiological criteria for foodstuffs. Official Journal of the European Union, p. L 338/1- L 338/26.
FAO "Food and Agriculture Organization "(1980): Manual of Food Quality Control. FAO, United Nation, Rome, Italy.
FDA (Food Drug Administration) (2001): Food borne pathogenic microorganisms and natural toxins. Center for food safety and applied nutrition. US, FDA, Washington, DC.
Fei Wang, L.; Jiang, I.N. and Beilei, G.E. (2012): Loop-Mediated Isothermal Amplification Assays for Detecting Shiga Toxin-Producing Escherichia coli in Ground Beef and Human Stools. J. Clin. Microbiol. 50(1): 91–97.
FSIS, (2008): FSIS Issues Public Health Alert for Frozen, Stuffed Raw Chicken Products.
Goji, N.; Mathews, A.; Huszczynski, G.; Laing, C.R.; Gannon, V.P. and Graham, M.R. (2015): A new pyrosequencing assay for rapid detection and genotyping of Shiga toxin, intimin and O157-specific rfbE genes of Escherichia coli. J. Microbiol Methods., 109:167-179.
Grant, M.A.; Hedberg, C. and Johnson, R. (2011): Executive summary. The significance of non-O157 Shiga toxin producing Escherichia coli in food. Food Prot. Trends. 33–42
Grimont, P.A. and Weill, F.X. (2007): Antigenic formulae of the salmonella serovars. WHO Collaborating Centre for Reference and Research on salmonella, Institute Pasteur, Paris, France.
Gundogan, N.; Citak, S.; Yucel, N.; Olkkonen, L. and Devren, A. (2005): A note on the incidence and antibiotic resistance of Staphylococcus aureus isolated from meat and chicken samples. J. Meat Sci., 69:807810.
Gyles, C.L. (2007): Shiga toxin-producing Escherichia coli: An overview. J. Anim. Sci. 66: E45–E62.
Hiko, A.; Asrat, D. and Zewde, G. (2008): Occurrence of Escherichia coli O157:H7 in retail raw meat products in Ethiopia. J. Infect. Dev. Ctries. 1, 2(5): 389-393.
Ibrahim, H.M.; Reham, A. Amin; Omima, A. Saleh and El Shafay, M.S. (2013): Quality of beef and edible offal at abattoir level. Benha Veterinary Medical Journal, vol. 25, no. 2: 254-263.
ICMSF “International Commission on Microbiological Specification for Foods” (2006): Microorganism in foods, Microbial ecology of food commodities. 2nd ed. Klumer Academics, Plenum Publishers. U. K.
International commission of Microbiological Specification for Foods "ICMSF" (1996): Microorganisms in Food. I-Their Significance and methods of enumeration. 3rd Ed. Univ. of Toronto, Canada.
ISO (International Organization of Standardization) (2002): International Organization for Standardization. No.6579. Microbiology of food and animal feeding Stuffs-Horizontal methods for detection of Salmonella species.
Jacob, M.E.; Foster, D.M.; Rogers, A.T.; Balcomb, C.C. and Sanderson, M.W. (2015): Prevalence and Relatedness of Escherichia coli O157:H7 Strains in the Feces and on the Hides and Carcasses of U.S. Meat Goats at Slaughter. Applied and Environmental Microbiology, 81(1):462.
Jay, J.M. (2000): Food preservation with modified atmospheres, p. 283-295. In D.R. Heldman (ed.), Modern food microbiology. Aspen Publishers, Inc. Gaithersburg,
Johnson, R.P.; Clarke, R.C. and Wilson, J.B. (1996): Growing concerns and recent outbreaks involving non O157:H7 verotoxigenic Escherichia coli. J. Food Prot., 59:1112–1122.
Jomezadeh, N.; Babamoradi, S.; Kalantar, E. and Javaherizadeh, H. (2014): Isolation and antibiotic susceptibility of Shigella species from stool samples among hospitalized children in Abadan, Iran. Gastroenterology and Hepatology from Bed to Bench, 7(4): 218–223.
Kayaardi, S.; Kayacier, Q.A. and Gok, V. (2006): Sensory and chemical analysis of Doner Kebab made from turkey meat. J. Muscle Food, 17:165-173.
Khaitsa, M.L.; Kegode, R.B.; Bauer, M.L. and Doetkott, D.K. (2007): Longitudinal study of Salmonella shedding and antimicrobial resistance patterns in North Dakota feed lot cattle. J. Food Prot.70 (2) 476-481.
Kirk, R.S. and Sawyers, R. (1991): Pearson's Composition and analysis of foods. 9th Ed. Longman Scientific and technical, London, UK.
Koutsoumanis, K.P.; Stamatiou, A.P.; Drowsing, E.S. and Nychas, C.J.E. (2008): Contro of spoilage microorganism in minced pork by self developed modified atmosphere induced by the respiratory activity of meat micro flora. Food Micrbiol., 25: 915-921.
Lee, G.Y.; Jang, H.I.; Hwang, I.G. and Rhee, M.S. (2009): Prevalence and classification of pathogenic Escherichia coli isolated from fresh beef, poultry and pork in Korea. International Journal of Medical Microbiology, 134(3): 196-200.
Lues, J.F.R.; Rasephei, M.R.; Venter, P. and Theron, M.M. (2006): Assessing food safety and associated food-handling practices in Street food vending. Int. J. Environmental Health Research, 16(5): 319-328.
Manna, S.K. (2006): Detection of Escherichia coli O157 in foods of animal origin by culture and multiplex polymerase chain reaction. J. Food Sci. Technol., 43(1): 77-79.
Mohamed, A.A.; Hussein, S.Z. and Farrag, S.A. (2004): Antibacterial of garlic, Nigella sativa and antibiotics on Bacillus cereus and Streptococcus fecalis isolated from ready-to-eat meat sandwiches in Assiut City. Assiut veterinary Medical Journal, 50(101): 78-93.
Mohamed, G. (2001): Ready-to-Eat Meat Sandwiches as a source of potential pathogens in Assiut city. MSc, Assiut University, Assiut, Egypt.
Murugkar, H.V.; Rahman, H. and Dutta, P.K. (2003): Distribution of virulence genes in Salmonella serovars isolated from man and animals. Indian J. Med. Res., 117:66-70.
Nakano, M.; Itoh, Y.; Yamada, Y.; Nakamura, K.; Sumitomo, M. and Nitta, M. (2012): Enhancement of enterohemorrhagic E. coli O175:H7 stress tolerance via pre-heating. Molecular Medicine Reports Journal, 5(3): 715- 720.
Nouichi, S. and Hamdi, T.M. (2009): Superficial Bacterial Contamination of Ovine and Bovine Carcasses at El- Harrach Slaughterhouse (Algeria). European Journal of Scientific Research, 38(3): 474-485.
Raharjo, S.J.N., Sofos, (1993): Methodology for measuring malonaldehyde as a product of lipid peroxidation in muscle tissues. J. Meat Sci. 35: 145- 169.
Rahimi, E.; Kazemeini, H.R. and Salajegheh, M. (2012): Escherichia coli O157: H7/NM prevalence in raw beef, camel, sheep, goat, and water buffalo meat in Fars and Khuzestan provinces, Iran. In Veterinary Research Forum (Vol. 3, No. 1, p. 15). Faculty of Veterinary Medicine, Urmia University, Urmia, Iran.
Rane-Sharmila (2011): Street vended food in developing world: hazard analyses. Indian J. Microbiol., 51(1): 100-106.
Reij, M.W. and Aantrekker, E.D.D. (2004): Recontamination as a source of pathogens in processed foods. International Journal of Food Microbiology, 91: 1-11.
Reij, M.W. and Aantrekker, E.D.D. (2004): Recontamination as a source of pathogens in processed foods. International Journal of Food Microbiology, 91: 1-11.
Salma J.I. Mohamed; Ali, M. Ahmed and Takwa H. Ismail (2015): Prevalence of Some Food-borne Pathogens in Cooked Liver Sandwich. 2nd Conference of Food Safety, Suez Canal University, Faculty of Veterinary Medicine Volume I August 2015 Page 82: 89.
Scotter, S.; Aldridge, M. and Capps, K. (2000): validation of method for the detection of E.coli O157:H7 in foods. Food Control, 11: 85-95.
Standbridge, L.H. and Davies, A.R. (1998): The microbiology of chill-stored meat, p. 175-177. In A. Davies and R. Board (ed.), Microbiology of meat and poultry Blackie Academic and professional, London, United Kingdom.
Suzzi, G.; Caruso, M.; Gardini, F.; Lombardi, A.; Vannini, L.; Guerzoni, M.E.; Andrighetto, C. and Lanorte, M.T. (2000): A Survey of the Enterococci Isolated from an Artisanal Italian Goat’s Cheese (Semicottocaprino). J. Appl. Microbiol., 89: 267-274.
Swanepoel, F.J.; Hobbs, C.; Becker, P.J. and Ijsselmuiden, C. (1998): The quality of food sold by traders in central Johannesburg and factors associated with contamination. J. Compr. Health 6:188-190.
Tambekar, D.H.; Jaiswal, V.J.; Dhanorkar, D.V.; Gulhane, P.B. and Dudhane, M.N. (2008): Identification of microbiological hazards and safety of ready-to-eat food vended in streets of Amravati City, India. J. Appl. Biosciences., 7: 195 – 201.
USA/FSIS (United State Department of Agriculture, Food Safety and Inspection Service) (2004): Microbiology Laboratory guidebook, 3rd ed., USDA Food Safety and Inspection Service, Washington, DC. Available on line at: http://www.fsis.usda.gov/Ophs/Microlab/ Mlg.p6.pdf.
دراسة عن بعض الممرضات المعوية لوجبات اللحوم من الأسواق
صابر على سعد ، هناء رشاد الحوفى ، سلوى عبد السلام هنداوى
E-mail: ahmadbkheet@yahoo.com Assiut University web-site: www.aun.edu.eg
تم تجميع 60 عينة من الشاورما وساندوتشات الکبدة والحواوشى (20 عينة من کل نوع) جمعت بطريقة عشوائية من مدينة دمنهور بمحافظة البحيرة. وکشفت النتائج أن متوسط النيتروجين الکلى المتصاعد فى عينات الشاورما, ساندوتشات الکبدة والحواوشى کان کالتالى (0.48 ± 27.8)، (0.17 ± 25.8) و(0.41 ± 27.6) وکان متوسط حمض الثيوباربتيورک فى عينات الشاورما, ساندوتشات الکبدة والحواوشى کالتالى (0.02 ± 0.71)، (0.33 ± 4.2) و (73.0 ± 01.(0. أظهرت النتائج أن متوسط العد الکلى للبکتريا کان (7.5x104±0.85x104), (4.8x104±0.50x104)و (4.5x104±0.48x104) فى عينات الشاورما, ساندوتشات الکبدة والحواوشى على التوالى وأظهرت النتائج أن نسبة الاصابة بميکروب المکورالمعوى والبکتربا القولونية الضارة وميکروب السالمونيلا وميکروب الشيجلا 25,20 ,25 ٪ و30,20, 25 % و 10, 15, 0 % و 15,10, 10 % في عينات الشاورما, ساندوتشات الکبدة والحواوشى على التوالى. وأوضح التصنيف السيرولوجى لميکروب الاشريکية القولونية الضارة عزل O128:K67 , O157:H7 O25:K72 ,O26:K60 ,O86:K61 بنسب 5, 10, 0, 5, 10 % و 0 ,10 ,5, 5 ,0% و 5 ,5 ,5 ,10,0% فى عينات لشاورما, ساندوتشات الکبدة والحواوشى على التوالى، وتم تصنيف السالمونيلا سيرولوجيا ووجد أن السالمونيلا أنتريتيدس, السالمونيلا تيفاى والسالمونيلا بارتيفاى موجودة بنسبة 5,5,0 % فى الشاورما و 5,5,5% فى ساندوتشات الکبدة ولم يتم عزل السالمونيلا من الحواوشى أما بالنسبة للتصنيف السيرولوجى لميکروب الشيجلا کان کالتالى شيجلا الزحار , شيجلا الفلکسنرى وشيجلا سونى بنسب 5, 5 ,5 % و5, 5, 0 % و 0 ,5, 5 % فى عينات الشاورما, ساندوتشات الکبدة والحواوشى على التوالى. وقد تم أستخدام تفاعل البلمرة المتسلسل لإکتشاف جين stn فى معزولة السالمونيلا عند وزنbp) 617) وجين stx1عند وزنbp) 614) وجينstx2 عند وزنbp) 779) فى معزولتين للايشيريکيا القولونية O157:H7 من الحواوشى والشاورما. هذا وقد تم دراسة ومناقشة الاهمية الصحية للميکروبات المعزولة وکذلک الشروط الصحية الواجب توافرها أثناء إعداد وتقديم هذه الساندوتشات لتجنب خطر هذه الميکروبات الضارة. مع اهمية استخدام لحوم وکبد جيدة المواصفات مع المعاملات الحرارية اللازمة وضرورة تشديد الرقابة على محلات البيع.