PREVALENCE OF VIRULENCE GENES OF SOME FOODBORNE BACTERIA IN CHICKEN MEAT PRODUCTS

Authors

1 Food Hygiene Dept. Mansoura Provential Lab, Animal Health Research Institute, Egypt

2 Microbiololgy Dept. Mansoura Provential Lab, Animal Health Research Institute, Egypt

Abstract

This Study was carried out on 200 random samples of chicken meat products represented by chicken luncheon, chicken burger, chicken sausage and chicken shawerma (50 of each). Samples were randomly collected from different supermarkets and retailers of different sanitation levels at Mansoura city, El Dakahlia Province, Egypt and bacteriologically analyzed to assess the prevalence of Staph. aureus, E. coli and S. spp < em>. and their enterotoxigenic virulence genes using PCR in some chicken meat products intended for direct consumption. The obtained results revealed that the prevalence of Staph. aureus in examined chicken luncheon, chicken burger, chicken sausage and chicken shawerma were 6%, 2%, 2% and 2%., respectively. While E. coli were 2%, 4%, 0% and 2% in examined samples respectively and S. spp. was isolated by 2% from shawerma only. The isolated S. typhimurium harbor invA and stn genes. The isolated E. coli showed presence of shiga toxin genes (stx1 and stx2). The examined coagulase positive Staph. aureus showed the presence of different enterotoxin genes sea, seb, sec, sed and see. Thus it is necessary to adopt a regime of good, safe and healthy production of such chicken meat products with cleaning and disinfection and hygienic packaging in order to ensure safe products for consumers.

Keywords


Assiut University web-site: www.aun.edu.eg

 

PREVALENCE OF VIRULENCE GENES OF SOME FOODBORNE BACTERIA IN CHICKEN MEAT PRODUCTS

 

NASHWA, M. ZAKI 1; EL-DOSOKY. H.F.A1; and WAFAA, M. GAD2

1 Food Hygiene Dept. Mansoura Provential Lab, Animal Health Research Institute, Egypt

2 Microbiololgy Dept. Mansoura Provential Lab, Animal Health Research Institute, Egypt

 

Received: 23 March 2017;       Accepted: 13 April2017

 

 

ABSTRACT

 

This Study was carried out on 200 random samples of chicken meat products represented by chicken luncheon, chicken burger, chicken sausage and chicken shawerma (50 of each). Samples were randomly collected from different supermarkets and retailers of different sanitation levels at Mansoura city, El Dakahlia Province, Egypt and bacteriologically analyzed to assess the prevalence of Staph. aureus, E. coli and S. spp. and their enterotoxigenic virulence genes using PCR in some chicken meat products intended for direct consumption. The obtained results revealed that the prevalence of Staph. aureus in examined chicken luncheon, chicken burger, chicken sausage and chicken shawerma were 6%, 2%, 2% and 2%., respectively. While E. coli were 2%, 4%, 0% and 2% in examined samples respectively and S. spp. was isolated by 2% from shawerma only. The isolated S. typhimurium harbor invA and stn genes. The isolated E. coli showed presence of shiga toxin genes (stx1 and stx2). The examined coagulase positive Staph. aureus showed the presence of different enterotoxin genes sea, seb, sec, sed and see. Thus it is necessary to adopt a regime of good, safe and healthy production of such chicken meat products with cleaning and disinfection and hygienic packaging in order to ensure safe products for consumers.

 

Key words: Prevalence, Virulent Genes, Foodborne Bacteria, Chicken, Meat Products.

 

 


INTRODUCTION

 

Poultry meat and its products are very popular food throughout the world, it considered as cheap, good delicious and nutritious, source of protein with good flavour and easily digestion. Ready to eat food can be described as the status of food being ready for immediate consumption at the point of sale, it may be raw or cooked, and can be consumed without further treatment Tsang (2002). The importance of food as a vehicle for transmission of several diseases has been documented, especially in developing countries where the hygienic standards are not strictly followed or enforced Harakeh et al. (2005). Staph. aureus produces a wide variety of toxins including staphylococcal enterotoxins (SEs; SEA to SEE, SEG to SEI, SER to SET) with demonstrated emetic activity, SEs are a major cause of food poisoning, which typically occurs after ingestion of different foods, particularly chicken meat products, contaminated with Staph. aureus by improper handling and subsequent storage at elevated temperatures

 

 

 


Corresponding author: Dr. NASHWA, M. ZAKI

E-mail address: nashwazaki80@gmail.com

Present address: Food Hygiene Dept. Mansoura Provential Lab, Animal Health Research Institute, Egypt

Tharwat and Elabbasy (2014). Salmonellosis was one of the most commonly zoonotic disease accounting for 133,258 confirmed humancases Osek and Wieczorek (2010). Salmonella often present in fresh tissues due to defects during slaughtering process of poultry and carcass manipulation Lee et al. (1998) as well as Cebedo et al. (2008) concluded that S. spp. are pathogenic bacteria that can contaminate food products during or after processing. Hamilton et al. (2009) mentioned that E.coli was isolated from 60% of examined poultry from butcher shops with mean counts of 0.70 log10 cfu/g. and 16% from poultry sold in supermarket samples with mean counts of 0.51 log10 cfu/g. Matossian and Kingcott (1979) detected food poisoning outbreak from donar kebab (a product similar to shawerma). Staphylococcus spp., E.coli and S. spp. were isolated from raw chicken products and chicken shawerma Kaneko et al. (1999) and Pelczar et al., 2006). Shiga toxin (Stx)-producing E. coli (STX-EC), also known as Verotoxin-producing E. coli which associated with infantile diarrhea, haemorrhagic colitis, thrombocyticpurpura, and hemolytic uremic syndrome in humans Griffin and Tauxe (1991). The aim of this study was to assess the presence of these bacteria in some chicken meat products and the risk of contamination on the consumer.

 


MATERIALS AND METHODS

 

1- Collection of samples:

Two hundred samples of chilled chicken meat products (50 samples each of chicken luncheon, chicken burger, chicken sausage and chicken shawerma) at ± 4o C were collected aseptically from different shops (small grocery and large supermarkets) from Mansoura city, Dakahlia province and transferred to the laboratory in an insulated ice-box without delay.

 

2- Bacteriological examination:

 

2.1- Preparation of food homogenate: according to technique recommended by ISO, 6887-2, (2003) 25 g. of each sample was removed by a sterile scissors and forceps and stomached using Seward stomacher 80 biomaster England with 225 ml sterile buffered peptone water (0.1%) to give a homogenate of 1/10 dilution from which ten fold serial dilutions were prepared and subjected to the following bacteriological examination.

 

2.2- Total E.coli count: according to technique recommended by FDA (2002a).

 

2.3- Staphylococcus aureus count: FDA (2002b). using Baird-Parker agar plates, incubated at 35 oC for 48 hr. The suspected Staphaureus colonies were isolated, purified and confirmed by coagulase test and the total count was calculated.

 

2.4- Isolation of E. coli according to technique recommended by ISO, 16649/2, (2001)

 

2.5- Isolation of Salmonellae ISO, 6579 (2002): by enrichment in peptone water at (37 oC for 24hr) then selection enrichment in Tetrathionate (37 oC for 24hr) and rappaportvasiliades at 41.5 oC for 18 hr., platting on XLD, MaCconkey's and Hektoneentreic agar at 37oC for 24 hr. The presumptive colonies were confirmed biochemically and serologically.

 

3- Detection of virulence genes in Staphaureus, E. coli and Salmonella using PCR:

Carried out in Reference Lab for Quality Control on Poultry Production, Animal Health Research Institute, Dokki-Egypt.

 

3.1- DNA extraction:

DNA extraction from positive samples were(6 Staph. aureus), (4E. coli) and (1 Salmonella) performed using the QIAamp DNA Mini kit (Qiagen, Germany, GmbH) with modifications from the manufacturer’s recommendations. Briefly, 200 µl of the sample suspension was incubated with 10 µl of proteinase K and 200 µl of lysis buffer at 56OC for 10 min. After incubation, 200 µl of 100% ethanol was added to the lysate. The samplewas then washed and centrifuged following the manufacturer’s recommendations. Nucleic acid was eluted with 100 µl of elution buffer provided in the kit.

 

3.2- Oligonucleotide Primers:

The used Primers used were supplied from Metabion (Germany) are listed in Table (I) and Table (II).

 

3.3- PCR amplification:

For uniplex PCR, primers were utilized in a 25- µl reaction containing 12.5 µl of Emerald Amp Max PCR Master Mix (Takara, Japan), 1 µl of each primer of 20 pmol concentrations, 4.5 µl of water, and 6 µl of DNA template. For stx1, stx2 duplex PCR, primers were utilized in a 50- µl reaction containing 25 µl of Emerald Amp Max PCR Master Mix (Takara, Japan), 1 µl of each primer of 20 pmol concentration, 13 µl of water, and 8 µl of DNA template. The reaction was performed in an appliedbiosystem 2720.

 

3.4- Analysis of the PCR Products:

The products of PCR were separated by electrophoresis on 1.5% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature using gradients of 5V/cm. For gel analysis, 20 µl of the uniplex PCR products and 30 µl of the duplex PCR products were loaded in each gel slot. Generuler 100 bp ladder (Fermentas, Thermo Scientific, Germany) was used to determine the fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra) and the data was analyzed through computer software.

 

 


 

 


Table I: primer sequence for Staph. aureus enterotoxins genes used in multiplex PCR (Mehrotra et al., 2000).

 


Primer pairs

Nucleotide sequence(5′→3′)

Amplicon size (bp)

sea

Forward

Reverse

5` GGTTATCAATGTGCGGGTGG 3`

5` CGGCACTTTTTTCTCTTCGG  3`

102 bp

seb

Forward

Reverse

5` GTATGGTGGTGTAACTGAGC 3`

5` CCAAATAGTGACGAGTTAGG 3`

164 bp

sec

Forward

Reverse

5`AGATGAAGTAGTTGATGTGTATGG 3`

5` CACACTTTTAGAATCAACCG 3`

451 bp

sed

Forward

Reverse

5` CCAATAATAGGAGAAAATAAAAGG 3`

5` ATTGGTATTTTTTTTCGTTC 3`

278 bp

see

Forward

Reverse

5`AGGTTTTTTCACAGGTCATCC 3`

5`CTTTTTTTTCTTCGGTCAATC 3`

209bp

 

Table II: Primers sequences, target genes, amplicon sizes and cycling conditions.

 

Target gene

Primers sequences

Amplified segment (bp)

Primary

denaturation

Amplification (35 cycles)

Final extension

Reference

Secondary denaturation

Annealing

Extension

stn

TTG TGT CGC TAT CAC TGG CAA CC

617

94˚C

5 min.

94˚C

30 sec.

59˚C

45 sec.

72˚C

45 sec.

72˚C

10 min.

  Murugkar

et al., 2003

ATT CGT AAC CCG CTC TCG TCC

invA

GTGAAATTATCGCCACGTTCGGGCAA

284

94˚C

5 min.

94˚C

30 sec.

55˚C

30 sec.

72˚C

30 sec.

72˚C

7 min

Oliveira

et al., 2003

TCATCGCACCGTCAAAGGAACC

Stx1

ACACTGGATGATCTCAGTGG

614

94˚C

5 min.

94˚C

30 sec.

58˚C

45 sec.

72˚C

45 sec.

72˚C

10 min.

Dipineto

et al., 2006

 

CTGAATCCCCCTCCATTATG

Stx2

CCATGACAACGGACAGCAGTT

779

CCTGTCAACTGAGCAGCACTTTG


 


Statistical analysis:

The results are expressed as mean ± standard Error (SE). Data were statistically analyzed using statistical analysis systems. (SAS version 9.1, SAS Institute, Inc., 2003).

 

RESULTS

 

The achieved results of Staph. aureus in Tables (1 & 2) for Chicken luncheon, Chicken burger, Chicken sausage and Chicken shawerma were 3.2±1.6, 3.5±1.5, 3.6±1.4 and 3.7±1.3 log10cfu/g. with incidence rate 6%, 2%, 2% and 2 %, respectively. The results of E. coli in Tables (1,2) for Chicken luncheon, Chicken burger, Chicken sausage and Chicken shawerma were 3.4±1.8, 3.1±1.3, 3.7±2.1 and 3.8±1.5 log10 cfu/g. with incidence rate 2%, 4%, 0% and 2%, respectively, serologically the isolated E. coli indicates presence of the enterotoxigenic strains E. coli O127:H6 in chicken luncheon and E. coli O125:H21 and E. coli O127:H6 in chicken burger. Salmonella were not detected in Chicken luncheon, Chicken burger and Chicken sausage and detected in 2% of the examined chicken shawerma was S. typhimurium.

 

By PCR the results showed the presence of enterotoxin producing genes (A, C, D and E) in Staph. Aureus the three isolates of Staph. aureus isolated from luncheon showed the presence of  enterotoxin gene 1st (A, E) , 2nd (A, D) and 3rd (B, D). The isolate of Staph. aureus isolated from burger showed presence of enterotoxin genes (A and E), the sausage isolate showed the presence of enterotoxin gene (A) while shawerma isolate showed presence of enterotoxin genes (A) .The virulence genes of shiga toxin (stx1 and stx2) were examined using PCR in the four E. coli isolates the results were postive for these genes.

 

 

Table1: Statistical analytical results of Staph. Aureus and E. coli in the examined samples expressed as log10cfu/g.(n=50).

 

Chicken shawerma

Chicken sausage

Chicken burger

Chicken luncheon

Microbial count

log10cfu/gm ±S.E.

3.7±1.3

3.6±1.4

3.5±1.5

3.2±1.6

STAPH.aureus

3.8±1.5

3.7±2.1

3.1±1.3

3.4±1.8

E. coli

 

Table 2: The incidence, Serotyping and virulence gene of isolated, Staph. Aureus, E. coli and S. spp. from the examined samples (N= 50 of each).

 

Chicken shawerma

Chicken sausage

    Chicken burger

Chicken luncheon

samples

 

Strains & virulence gene

NO

%

Strains & virulence gene

NO

%

Strains & virulence  gene

NO

%

Strains & virulence  gene

NO

%

 

Strains

 

sea

Cp

1(2%)

sea

Cp

1(2%)

sea, sed

Cp

1(2%)

1st sea, see

2nd sea, sed

3rd seb, sed

Cp

  3(6%)

 Staph. aureus

 

 

ETEC

O125:H21

Stx1 and stx2

1

(2%)

-

ND

-

1st

ETEC

O125:H21

Stx1 and stx2

2

(4%)

ETEC O127:H6

Stx2

1

(2%)

E. coli

S. typhimurium inv A, and stn,

1

(2%)

-

ND

-

ND

-

ND

S. SPP.

ND. = not determined

No. = number of positive samples, C p =coagulase positive

 


DISCUSSION

 

Staph. aureus, E. coli and Salmonella are the major causes of food borne infection and intoxication and their presence in food conistitute an important hygienic problem for food processors, food handlers and consumers Bergadol (1989). The enterotoxication generally is not lethal and the elderly are more susceptible than the younger individuals, where the amount of STAPH. aureus enterotoxins required for intoxication about 94-184 ug Erol and Iseri, (2004).

 

The achieved results of Staph. aureus in Tables (1 & 2) for Chicken luncheon, Chicken burger, Chicken sausage and Chicken shawerma were 3.2±1.6, 3.5±1.5, 3.6±1.4 and 3.7±1.3 log10cfu/g. with incidence rate 6%, 2%, 2% and 2 % respectively. The results nearly similar Saleh et al. (2010) who mentioned that Staph. Aureus count were 1.14x103±3.32x102, 2.17x103±4.31x102 and 2.2x103± 4.45x102/g. with different  incidence of 4%,12% and 16% for luncheon, beef-burger and sausage respectively higher percentage were reported by Amal, (2004) 15% and 25% in Staph. aureus for luncheon and fresh sausage; Fatin, (2004) could isolate Staph. Aureus from  luncheon in percentage of 16%; and Soultos et al. (2003) in percentage of 19.4% in luncheon; Mousa, (1993) reported that S. aureus count was 2.3x104cfu/g. for luncheon.; Ahmed, (1992) 6.6% in sausage. EL-Mossalami et al. (2009) detected Staph. aureus in 92%, 80% and 88% with mean values of 3.25±6x103, 2.8±1.4x102 and 4.1±2x103cfu/g. in sausage, beef burger and shawerma respectively; Armany et al. (2016) could isolate S. aureus in percentage of24% and 20% in raw sausage and luncheon; Shawish and AL-Humam (2016) were 12%,22% and  30% in beef luncheon, beef burger and beef sausage; AL-Ghamdi, (2012) S. aureus count in chicken luncheon and chicken burger were 1.47x106 and 1.2x107cfu/g respectively. Ibrahim, (2009) detected Staph. aureus in 22.85% and 31.85% in luncheon, and sausage and EL-Khatieb (1997) (29%) in sausage. the percentage of coagulase positive Staph. aureus  strains isolated from Chicken luncheon, Chicken burger, Chicken sausage and Chicken shawerma were 6%,2%, 2%  and 2% respectively as in Table (2). Chomvarin et al. (2006); Oh, et al. (2007) and Chiang et al. (2008) concluded that the occurrence of enterotoxigenic Staph. Raureus in ready to eat food products has been reported in various parts all over the world; Shalaby and Zaki, (2008) could isolate 4, 5 and 3enterotoxigenic strains of Staph. aureus from beef burger, sausage and shawerma respectively and Motten et al. (2011) found Coagulase positive Staph. aureus in luncheon by 7%, 7% and 5% from the collected samples from three supermarkets. Eldaly et al. (2014) showed that the isolation percentages of Staph. aureus in the examined samples of luncheon, burger, and sausage were 15%, 10%, and 20% respectively.

 

The results of E. coli in Tables (1,2) for Chicken luncheon, Chicken burger, Chicken sausage and Chicken shawerma were 3.4±1.8, 3.1±1.3, 3.7±2.1 and 3.8±1.5 log10 cfu/g. with incidence rate 2%,4%,0% and 2% respectively, serologically the isolated E. coli indicates presence of the enterotoxigenic strains E. coli O127:H6 in chicken luncheon and E. coli O125:H21 and E. coli O127:H6 in chicken burger. These results nearly similar to Samaha et al. (2012) were 8% in chicken luncheon; Ibrahim (2009) were 5.71% in luncheon; Fawzy (2004) were 8% in luncheon and Amal (2004) were 5 and 25% in luncheon and fresh sausage. Meanwhile, higher results were recorded by Armany et al. (2016) 20% and 24% in raw sausage and luncheon respectively and Mousa (1993) were14% in luncheon; Ibrahim, (2009) were 42.85% in sausage and Fathi et al. (1992) in luncheon and sausage which were 41.67% and 20%which may be due to post processing contamination or unefficient cooking and improper handling.

 

Salmonella were not detected in Chicken luncheon, Chicken burger and Chicken sausage and detected in 2% of the examined chicken shawerma was S. typhimurium. EL Jakee et al. (2014) detect Salmonella in burger, sausage and poultry products by 10, 35 and 25% respectively, the isolated Salmonella were S. enteritidis and S. typhimurium and Samaha et al. (2012) could isolate  8% Salmonella in chicken luncheon, Amal (2004); Ibrahim (2009) and Saleh et al. (2010) can not find Salmonella in luncheon while in sausage Mousa (1993); Saleh et al. (2010); Kozacinski et al. (2008); Ibrahim (2009); and Tudor et al. (2010) can't found S. spp. in fermented sausage. Amal (2004) found salmonella by 5% in sausage. The health hazard from Salmonella must not be underestimated. The fact that Salmonella was detected in samples from supermarkets, where chicken are displayed under refrigeration, shows that the spread of infection was not only confined to seemingly unhygienic environments FAO, (2013). It was suggested that to prevent contamination by Salmonella control measures must be taken at all stages of the food chain, from agricultural production, to processing, manufacturing and preparation of foods in both commercial establishments and at home WHO (2013).  

 

PCR was applied to evaluate the presence of virulence genes in the isolated Staph. aureus, E. coli and Salmonella. Staph. aureus is one causes of food poisoning, its pathogenicity result from possession of virulence genes that produce different toxins which result in self-limiting sever illness. For this reason the virulence genes of 6 isolated coagulase positive Staph. aureus were examined by PCR and the results  showed the presence of enterotoxin producing genes (A, C, D and E) in Staph. aureus the three isolates of Staph. aureus isolated from luncheon showed the presence of  enterotoxin gene 1st(A, E) , 2nd (A, D) and 3rd (B, D). The isolate of Staph. aureus isolated from  burger  showed presence of  enterotoxin  genes (A and E), the sausage  isolate showed the presence of enterotoxin gene (A) while shawerma isolate showed presence of enterotoxin genes(A) as shown in Table (I) (Photo No. 1). The result agree with Eldalyet al. (2014) who found that luncheon samples harbored seb gene s while burger samples harbored sed gene also Tharwat and Elabbasy (2014) reported that SEA enterotoxin gene was the predominant enterotoxin genes which were detected in examined chicken burger and chicken luncheon.

 

Staph. aureus enterotoxin were analyzed from ready to eat products including pork ham, chicken cold cuts, pork sausage, salami and pork luncheon meat in a study conducted by Fijalkowski et al. (2016), this study reported that the most prevalent enterotoxin genes were sei (36%), seln (32%) and encoding exfoliative toxin A (37%). Another study conducted by Puah et al. (2016) revealed an incidence of (96.2%) virulence genes from Staph. aureus isolated from 200 food samples. A total of 30.8% of the isolates carried SE gene which cause food poisoning meanwhile the most common enterotoxin genes found were seg (11.5%) and egc (5.8%). On the other hands Inv A and stn virulence genes in the isolated S. Typhimurium were positive. InvA gene was amplified and detected at 284 bp while stn gene detected and amplified at 617 bp. In Korea, Li et al. (2006) could detect 17 virulence genes from isolated Salmonella using PCR assays, 14 genes assayed (82.4%) out of these 17 genes included invA gene.

 

The virulence genes of shiga toxin (stx1 and stx2) were examined using PCR in the four E. coli isolates the results were positive for these genes Table (2) (Photo No. 2), these results were nearly similar to Balague et al. (2006) who collected 500 food samples from shops selling ready to eat foods in Argentina and E. coli virulence gens were examined by multiplex PCR (stx1, stx2, eae A, cnf1, cnf2, ein v, Lt1, ST1 and ST11), ten E. coli isolates showed  the presence of stx1, stx2 genes while other genes were negative. Another study carried by Bohaychuck et al. (2006) reported shiga toxin producing E. coli O22: H8 from beef samples in Alberta and Canada.

 

 


 

 

 

Photo No. (1): Agarose gel electrophoresis of Staph. aureus PCR products using enterotoxins Staphylococcus primer.

Lane "1": 100 bp DNA ladder

Lane "2 ": positive amplification of 102 bp for enterotoxin A, 209 bp for enterotoxin E, 278 bp for enterotoxin D and 451 bp for enterotoxin C

Lane "3": positive amplification of 102 bp for enterotoxin A, 209 bp for enterotoxin E, 278 bp for enterotoxin D and 451 bp for enterotoxin C

Lane "4": positive amplification of 102 bp for enterotoxin A and 278 bp for enterotoxin D

Lane "5": positive amplification of 102 bp for enterotoxin A

Lane "6": positive amplification of 102 bp for enterotoxin A

Lane "7": posistive amplification of 164 bp for enterotoxin B and 278 bp for enterotoxin D

 

 

 

Photo No. (2): Agarose gel electrophoresis of and E. coli PCR products using stx1 and stx2 primers.

Lane "1": 100 bp DNA ladder

Lane "2 ": positive amplification of\614 bp for stx1 gene and 779 bp for stx2.

Lane "3": positive amplification of 779 bp for stx2.                 

Lane "4": positive amplification of \614 bp for stx1 gene and 779 bp for stx2.

Lane "5": positive amplification of 779 bp for stx2.

 

 

 

Photo No. (3): Agarose gel electrophoresis of Salmonella and PCR products using invA, and stn, primers

L= 100 bp DNA ladder.

N= negative control.

P= positive control (give amplificationat 617pb for stn gene, 284 bp for invA, 614 bp

Sample of S.Typhimurium showed 284 bp amplification for invA gene and 617 pb for stn gene.

 


CONCLUSION

 

This study confirms that chicken meat products may serve as a source of foodborne pathogens and accordingly a potential public health hazard. Corrective action needs to be employed to minimize the risk of consuming this type of fast food, such action must aim to minimizing the bacterial contamination during the production of chicken meat products (cleaning, cutting, seasoning and stacking), its cooking and serving. Regular surveillance by the public health regulatory bodies will ensure compliance with WHO and ISO standards for food safety.

 

Also, handling, storage and processing steps are major avenue for the cross contamination of the major materials used for the preparation of such product. Personal hygiene and processing practice of the food vendors are major factors.

 

REFERENCES

 

Ahmed, M. (1992): Incidence and Occurrence of Salmonella and E.coli in packed meat products in Assiut.  M.V.Sc. thesis, Fac. of Vet. Med. Assiut University.

AL-Ghamdi, A.Y. (2012): Incidence of Staphylococcus aureus contamination of marketed processed chicken products with special refercence to its antibiotic sensitivity collected from Al Baha city markets, Saudi Arabia. Pak. J. Food Sci. 22;3: 167-169.

Amal, A.S.A.T. (2004): Trials for inhibition of some food poisoning microorganisms in meat products. Ph. D.V. Sci. Fac. Vet. Med. Cairo Univ.

Armany, G.A.; Ibrahim, M. Hemmat; Amin, R.A. and Ahmed, A. Hanaa (2016): Detection of some foodborne pathogens in meat products by Polymerase Chain Reaction. Benha Vet. Med. J. 30, 1; 323-330.

Balague, C.; Khan, A.A.; Fernandez, L.; Redolfi, A.L.; Aquili, V.; Voltattorni, P.; Hofer, C.; Ebner, G.; Duenas, S. and Cerniglia, C.E. (2006): Occurrence of non O157 shiga toxin producing E.coli in ready to eat food from supermarkets in Argentina. Food Microbiol; 23(3): 307-313.

Bergadol, M.S. (1989): S. aureus in bacterial food borne pathogens, Editor Doyle M.P. Marcel Dekker press New York Occurrence of food borne pathogenic bacteria in refrigerated chicken meat. Hygiene Alimenter, 16, 100; 97-101.

Bohaychuck, V.M.; Gensler, G.E.; King, R.K.; Manninen, K.I.; Sorensen, O.; Wu, J.; Stiles, M.E. and McMullen, L.M. (2006): occurrence of pathogens in raw and ready to eat meat and poultry products collected from the retail market place in Edmonton, Alberta, Canada. J food Prot; 69(9): 2176-2182.

Cebedo, O.L.; Picart-i-Barrot, L. and Teixdoi-Canelles, A. (2008): Prevalence of Listeria monocytogenes and Salmonella in ready – to – eat food in Catalonia. Spain. J. Food Prot., 71; 4: 855-859.

Chiang, Y.C.; Liao, W.W.; Fan, C.M.; Pai, W.Y.; Chiou, C.S. and Tsen, H.Y. (2008): PCR detection of Staphylococcal enterotoxins (SEs) N,O,P,Q, R,U and survey of SE types in  S. aureus isolates from food poisoning cases in Taiwan. Int. J. Food.   

Chomavarin, C.; Chantarasuk, Y.; Srigulbur, S.; Chareonsudjai, S. and Chaicumper, K. (2006): Enteropathogenic bacteria and enterotoxin-producing Staph. aureus isolated from ready to eat food in Khon Kaen, Thailand. Southeast Asian J. Trop. Med. Public Health, 37; 983-990.

Dipineto, L.; Santaniello, A.; Fontanella, M.; Lagos, K.; Fioretti, A. and Menna, L.F. (2006): Presence of Shiga toxin-producing Escherichia coli O157:H7 in living layer hens. Letters in Applied Microbiology 43 (2006) 293–295.

Donelly, C.B.; Leslie, J.E.; Black, L.A. and Lewis, K.H. (1967): Serological identification of enterotoxigenic Staphylococci in cheese. Appl. Microbiol.15; 1382-1389.

EL Jakee, J.; Nagwa, S. Ata; Sherein I. Abd EL-Moez; Mai, M. Kandiel and Nermin, M. Radwan (2014): Assessment of the Prevalence of Salmonella in food. Int. J. of Current Microbiology Applied Sciences 3; 3: 30-42.

Eldaly, A. Elsaid.; El Shopary, F. Nermeen and El Bayomi, Rasha (2014): Detection of enterotoxigenic S. aureus prevalent genes in some meat products using Multiplex PCR. The 1st International Conference on Impact of Environmental Hazards on Food Safety Faculty of Veterinary Medicine- Zagazig University, 20th August, 2014.

EL-Khatieb, T. (1997): Microbiological status of Egyptian salted meat and fresh sausage. J. of Food Safety, 17 (3); 141-150.

El-Mossalami, H.H.A.; Abd-EL-Rahman, A.A. and Magdy, E.M. (2009): A study on the effect of Garlic and Nigella sativa on some food poisoning bacteria isolated from ready to- eat meat sandwiches in Alexandria City. Assiut Veterinary Medical Journal. 54; 119, 140-158.

Erol, I. and Iseri, O. (2004): Staphylococcal enterotoxins, Ankara Univeritesi Veteriner Fakultesi Dergisi, 51, 3; 239-245.

Fathi, S.M.; Rashwan, M.R. and EL-Said, S.I. (1992): Determination of coliforms and E.coli in some meat products using most probable number technique. Assiut Vet. Med. J. 24 (55): 180-185.

Fatin, S.H. (2004): Bacterial hazards associated with consumption of some meat products. Benha Vet. Med. J. 15 (2); 41-54.

Fawzy, A.A. (2004): Sudies on cooked meat and chicken products. Ph.D. Fac. of Vet. Med. Zagazig Univ. Benha branch.

FDA (2002a): Food and Drug Administration. Bacteriological Analytical Manual. 9th Ed., AOAC International, Arlington, VA, USA.

FDA (2002b): Food and Drug Administration: Enumeration of coliform bacteria and E.coli. Bacteriological Analytical Manual. Chapter4.

Fijalkowski, K.; Peitler, D. and Karakulsuka, J. (2016): Staphylococci isolated from ready to eat meat identification, antibiotic resistance and toxin gene profile. Int J. food Microbiol.; 238:113-120.

Food and Agriculture Organization (FAO) (2013): Poultry Development Review: Poultry and poultry products: Risks for human health by M Ventura da Silva, FAO Document Repository. Available at: http://www.fao.org/docrep/019/ i3531e/i3531e.pd

Griffin, PM. and Tauxe, RV. (1991): The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol Rev; 13: 60–98.

Hamilton, Holds, G.; Hols, G.; Lorimer, M.; Pointon, A. and Sumner, J. (2009):Micrbiology of beef sausages at retail in Australia. Food Australia.61; 12, 532-533.

Harakeh, S.; Yassinea, H.; Ghariosb, M.; Barbourc, E.; Hajjara, S.; El-Fadeld, M.; Toufeilib, I. and Tannous, R. (2005): Isolation, molecular characterization and antimicrobial resistance patterns of Salmonella and Escherichia coli isolated from meat-based fast food in Lebanon. Sci Total Environ 341: 33 - 44.

Ibrahim, M.I.A. (2009): Bacteriological quality and shelflife of some products. M.V. Sc. Thesis. Meat Hygiene, Fac. Vet. Med. Alex. Univ. in fast food with special reference to its enterotoxigenicity. Assiut Vet. Med. J. 54,112; 37-50.

ISO, 16649/2 (2001): Microbiology of Food and Animal Feeding Stuffs-Horizontal Method for the enumeration of beta - glucuronidase - positive E. coli: part 2: colony-count technique at 44ºC using 5-bromo -4-chloro-3-indoly beta-glucuronide

 ISO, 6579, (2002): Microbiology of Food and Animal Feeding Stuffs-Horizontal Method for the Detection of S. spp.

ISO, 6887/2 (2003): Microbiology of Food and Animal Feeding Stuffs-Preparation of Test Samples, Initial Suspension and Decimal Dilutions for Microb. Exam Egypt. J. Chem. Environ. Health, 1 (1):686-69 

Kaneko, K.; Hayashidani, H.; Ohtomo, Y.; Kosuge, J.; Kato, M.; Takahashi, K.; Shiraki, Y. and Ogauwa, M. (1999): Bacterialcontamination of ready to eat foods and fresh products in retail shops and food factories. J Food and Drug Analysis 1: 105-115.

Kozacinski, L.; Drosinos, E.; Caklovica, F.; Cocolin, L.; Gasparik-Reichandt, J. and Eskovic, S. (2008): Investigation of microbial association of traditionally fermented sausages. Food Technology and Biotechnology.46; 1,93-106.

Lee, A.; Smith, S.C. and Coloe, P.J. (1998): Survival and growth of Campylobacter jejuni after artificial inoculation onto chicken skin as a function of temperature and packaging conditions, J. Food Protection, 61: 1609-1614.

Li, Q.; Skyberg, J.A.; Fakhr, M.K.; Sherwood, J.S.; Molan, L.K. and logue, C.M. (2006): Antimicrobial susceptibility and characterization of Salmonella isolates from processed Bison carcass. APL Microbiol 72: 3046-3049.

Matossian, R. and Kingcott, E.W. (1979): The dona kebab a possible food poisoning hazard. Environm. Health. 86; 67-68.

Mehrotra, M.; Wang, G. and Johnson, M.W. (2000): Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxin, exfoliative toxins, toxic shock syndrome toxin 1, and Methicillin resistance. Journal of Clinical Microbiology, Vol. 38: 1032-1035.

Motten, Vanessa; Fisch Elisa and Cardoso Marisa (2011): Microbial contamination of luncheon meat sliced and packaged in supermarkets in Porto Alegre, Brazil. Acta Scientiae Veterinariae, 39; 1: 940-945.

Mousa, M.M.; Awad, H.A.; Yassien, M.M. and Gouda, H.I. (1993): Microbial quality of some meat products.Vet. Med. J. Giza. 41; 3,59-62.

Murugkar, H.V.; Rahman, H. and Dutta, P.K. (2003): Distribution of virulence genes in Salmonella serovars isolated from man and animals. Indian J. Med. Res., 117:66-70.

Oh, S.K.; Lee, N.; Cho, Y.S.; Shin, D.B.; Choi, S.Y. and Koo, M. (2007): Occurrence of toxigenic Staph. Aureus in ready to eat food in Korea. J. Food Protection, 70; 1153-1158.

Oliveira, S.D.; Rodenbusch, C.R.; Ce, M.C.; Rocha, S.L.S. and Canal, C.W. (2003): Evaluation of selective and non-selective en-richment PCR procedures for Salmonella de-tection. Lett. Appl. Microbiol., 36: 217-221.

Osek, J. and Wieczorek, K. (2010): Zoonosis and their etiological agents in the EFSA report for 2008. ZycieWeterynaryjne. 2010. 85: 4, 315-324.

Pelczar, MJ.; Chane, CS. and Kreig, NR. (2006): Microbiology 5th edition. Tata McGraw-Hill Publishing Company Limited, New Delhi.

Puah, S.M.; Chua, K.H. and tan, J.A. (2016): virulence factor and antibiotic susceptibility of Staph. Aureus isolates in ready to eat foods: detection of Staph. aureus contamination and a high prevalence of virulence genes. Int. J. Environ Res public health 5; 13(2)199.

Saleh, E.A.; Ali, H.A. and Abu-Khadra, A.M. (2010): Detection of some food poisoning microorganisms in some meat products. Alex. J. Vet. Sc. 31; 1, 27-33.

Samaha, I.A.; Ibrahim, H.A.A. and Hamada, M.O. (2012): Isolation of some enteropathogens from retailed poultry meat in Alexandria Province. Alex. J. Vet. Science 37; 1:  17-22.

SAS Institute (2003): SAS Proprietary Software. Re. 9.1. SAS Instit. Inc. Cary, NC.

Shalaby, M. Amany and Zaki, M.S. Eman (2008): Occurrence of Staphylococcus aureus in fast food with special reference to its enterotoxigenicity. Assiut Vet. Med. J. 54,112: 37-50.

Shawish, R.R. and AL-Humam, N.A. (2016): Contamination of beef products with Staphylococcal classical enterotoxin in Egypt and Saudi Arabia. Hygiene and Infection Control, 11; ISSN 2196-5226.

Soultos, N.; Abrahim, A. and Abrosiadis, I. (2003): Incidence of some food borne bacterial pathogens in northern Greece. Archiv Staph. Furer Lebensmittel. Hygiene 54,(3);55-57.

Tharwat, A. Elsayed and Elabbasy, M. Tharwat (2014): Classical Staphylococcus aureus Enterotoxins genes in some chicken meat products marketed in Zagazig city, Egypt. The 1st International Conference on Impact of Environmental Hazards on Food Safety Faculty of Veterinary Medicine- Zagazig University, 20th August, 2014.

Tsang, O. (2002): Guidelines for Ready-To-Eat Food. Road and Environmental Hygiene Department, Hong Kong.pp.15 – 16

Tudor, L.; Togoe, I. and Mitranescu, E. (2010): The microbiological quality analysis of some meat products traded on Bucharest markets. Lucrari Stiintifice-Universitatea de Stiinte Agricole a Banatului Timisoara, Medicina Veterinara. 40; 688-693.                  

World Health Organization (WHO) (2013): MEDIA Centre, Fact sheet N°139: Salmonella (non-typhoidal), Available at: http://www.who. nt/ media centre/ factsheets/fs139/en.

 

 

 

مدى تواجد جينات الضراوة ببعض البکتيريا المنقولة بالغذاء في بعض منتجات لحوم الدواجن

 

نشوى محمد ذکى , حاتم فتحى احمد الدسوقى ، وفاء محمد عبد الخبير جاد

 

Email: nashwazaki80@gmail.com          Assiut University web-site: www.aun.edu.eg

 

تم جمع 200 عينه من لانشون  وبيرجر وسجق وشاورما الدجاج  بواقع 50 عينه لکل منها. حيث تم عمل فحص  بکتيري لکل من الاستاف اوريس والايشيرشيا کولاى وکذا معرفة مدى تواجد ميکروب السالمونيلا حيث کانت نسب العزل لميکروب الاستاف اوريس کالتالي 6% و 2% و2 % و2% بينما نسب العزل للالايشيرشيا کولاى کالتالى  2% و 4%  و0% و 2% على الترتيب وتم عزل عترة السالمونيلا تيفيميوريم من شاورما الدجاج بنسبة 2 %. حيث تبين من هذه الدراسة ان عينات الانشون والسجق والهامبورجر کانت خالية من السالمونيلا عند الفحص البکتيريولوجي . تم عزل6 معزولات من ميکروب الاستاف اوريس (الموجبة لتجلط البلازما). تنتج المکورات العنقودية الذهبية مجموعة واسعة من السموم المعوية والتي تقوم بإثارة مراکز طالقئ في المخ وتشکل أحد الأسباب الرئيسية للتسمم الغذائي، والذي يحدث عادة بعد تناول الأطعمة المختلفة، لا سيما منتجات لحوم الدجاج الملوثة بالمکورات العنقودية الذهبية عن طريق سوء التعامل والتخزين في درجات حرارة مرتفعة بالإضافة لما تسببه کل من ميکروب السالمونيلا والايشيريشياکولاى من حالات الإسهال الحاد لذلک تم تي تؤثر على قدرة الميکروب على احداث حالات مرضية عند تناول الاطعمة الملوثة بهذه الميکروبات. عند فحص السالمونيلافحص جينات الضرواه  لکل منهما. واجراء اختبار تفاعل البلمرة المتسلسل لتحديد وجود جينات الضراوة في الميکروبات المعزولة وال تيفيميوريم المعزولة اظهرت وجود  جيني invAstn,. وبفحص معزولات ميکروب الايشيرشياکولاى المعزولة تواجد بها جيني stx1 , stx2 کما أثبتت تواجد معظم جينات الضراوه لميکروب الستاف اوريس المعزول من العينات. وقد نقشت الأهمية الصحية للمعزولات وکذلک کيفية الإقلال من تواجدها باتباع نظم إدارة سلامة الغذاء أثناء التصنيع.

 

 
 
Ahmed, M. (1992): Incidence and Occurrence of Salmonella and E.coli in packed meat products in Assiut.  M.V.Sc. thesis, Fac. of Vet. Med. Assiut University.
AL-Ghamdi, A.Y. (2012): Incidence of Staphylococcus aureus contamination of marketed processed chicken products with special refercence to its antibiotic sensitivity collected from Al Baha city markets, Saudi Arabia. Pak. J. Food Sci. 22;3: 167-169.
Amal, A.S.A.T. (2004): Trials for inhibition of some food poisoning microorganisms in meat products. Ph. D.V. Sci. Fac. Vet. Med. Cairo Univ.
Armany, G.A.; Ibrahim, M. Hemmat; Amin, R.A. and Ahmed, A. Hanaa (2016): Detection of some foodborne pathogens in meat products by Polymerase Chain Reaction. Benha Vet. Med. J. 30, 1; 323-330.
Balague, C.; Khan, A.A.; Fernandez, L.; Redolfi, A.L.; Aquili, V.; Voltattorni, P.; Hofer, C.; Ebner, G.; Duenas, S. and Cerniglia, C.E. (2006): Occurrence of non O157 shiga toxin producing E.coli in ready to eat food from supermarkets in Argentina. Food Microbiol; 23(3): 307-313.
Bergadol, M.S. (1989): S. aureus in bacterial food borne pathogens, Editor Doyle M.P. Marcel Dekker press New York Occurrence of food borne pathogenic bacteria in refrigerated chicken meat. Hygiene Alimenter, 16, 100; 97-101.
Bohaychuck, V.M.; Gensler, G.E.; King, R.K.; Manninen, K.I.; Sorensen, O.; Wu, J.; Stiles, M.E. and McMullen, L.M. (2006): occurrence of pathogens in raw and ready to eat meat and poultry products collected from the retail market place in Edmonton, Alberta, Canada. J food Prot; 69(9): 2176-2182.
Cebedo, O.L.; Picart-i-Barrot, L. and Teixdoi-Canelles, A. (2008): Prevalence of Listeria monocytogenes and Salmonella in ready – to – eat food in Catalonia. Spain. J. Food Prot., 71; 4: 855-859.
Chiang, Y.C.; Liao, W.W.; Fan, C.M.; Pai, W.Y.; Chiou, C.S. and Tsen, H.Y. (2008): PCR detection of Staphylococcal enterotoxins (SEs) N,O,P,Q, R,U and survey of SE types in  S. aureus isolates from food poisoning cases in Taiwan. Int. J. Food.   
Chomavarin, C.; Chantarasuk, Y.; Srigulbur, S.; Chareonsudjai, S. and Chaicumper, K. (2006): Enteropathogenic bacteria and enterotoxin-producing Staph. aureus isolated from ready to eat food in Khon Kaen, Thailand. Southeast Asian J. Trop. Med. Public Health, 37; 983-990.
Dipineto, L.; Santaniello, A.; Fontanella, M.; Lagos, K.; Fioretti, A. and Menna, L.F. (2006): Presence of Shiga toxin-producing Escherichia coli O157:H7 in living layer hens. Letters in Applied Microbiology 43 (2006) 293–295.
Donelly, C.B.; Leslie, J.E.; Black, L.A. and Lewis, K.H. (1967): Serological identification of enterotoxigenic Staphylococci in cheese. Appl. Microbiol.15; 1382-1389.
EL Jakee, J.; Nagwa, S. Ata; Sherein I. Abd EL-Moez; Mai, M. Kandiel and Nermin, M. Radwan (2014): Assessment of the Prevalence of Salmonella in food. Int. J. of Current Microbiology Applied Sciences 3; 3: 30-42.
Eldaly, A. Elsaid.; El Shopary, F. Nermeen and El Bayomi, Rasha (2014): Detection of enterotoxigenic S. aureus prevalent genes in some meat products using Multiplex PCR. The 1st International Conference on Impact of Environmental Hazards on Food Safety Faculty of Veterinary Medicine- Zagazig University, 20th August, 2014.
EL-Khatieb, T. (1997): Microbiological status of Egyptian salted meat and fresh sausage. J. of Food Safety, 17 (3); 141-150.
El-Mossalami, H.H.A.; Abd-EL-Rahman, A.A. and Magdy, E.M. (2009): A study on the effect of Garlic and Nigella sativa on some food poisoning bacteria isolated from ready to- eat meat sandwiches in Alexandria City. Assiut Veterinary Medical Journal. 54; 119, 140-158.
Erol, I. and Iseri, O. (2004): Staphylococcal enterotoxins, Ankara Univeritesi Veteriner Fakultesi Dergisi, 51, 3; 239-245.
Fathi, S.M.; Rashwan, M.R. and EL-Said, S.I. (1992): Determination of coliforms and E.coli in some meat products using most probable number technique. Assiut Vet. Med. J. 24 (55): 180-185.
Fatin, S.H. (2004): Bacterial hazards associated with consumption of some meat products. Benha Vet. Med. J. 15 (2); 41-54.
Fawzy, A.A. (2004): Sudies on cooked meat and chicken products. Ph.D. Fac. of Vet. Med. Zagazig Univ. Benha branch.
FDA (2002a): Food and Drug Administration. Bacteriological Analytical Manual. 9th Ed., AOAC International, Arlington, VA, USA.
FDA (2002b): Food and Drug Administration: Enumeration of coliform bacteria and E.coli. Bacteriological Analytical Manual. Chapter4.
Fijalkowski, K.; Peitler, D. and Karakulsuka, J. (2016): Staphylococci isolated from ready to eat meat identification, antibiotic resistance and toxin gene profile. Int J. food Microbiol.; 238:113-120.
Food and Agriculture Organization (FAO) (2013): Poultry Development Review: Poultry and poultry products: Risks for human health by M Ventura da Silva, FAO Document Repository. Available at: http://www.fao.org/docrep/019/ i3531e/i3531e.pd
Griffin, PM. and Tauxe, RV. (1991): The epidemiology of infections caused by Escherichia coli O157:H7, other enterohemorrhagic E. coli, and the associated hemolytic uremic syndrome. Epidemiol Rev; 13: 60–98.
Hamilton, Holds, G.; Hols, G.; Lorimer, M.; Pointon, A. and Sumner, J. (2009):Micrbiology of beef sausages at retail in Australia. Food Australia.61; 12, 532-533.
Harakeh, S.; Yassinea, H.; Ghariosb, M.; Barbourc, E.; Hajjara, S.; El-Fadeld, M.; Toufeilib, I. and Tannous, R. (2005): Isolation, molecular characterization and antimicrobial resistance patterns of Salmonella and Escherichia coli isolated from meat-based fast food in Lebanon. Sci Total Environ 341: 33 - 44.
Ibrahim, M.I.A. (2009): Bacteriological quality and shelflife of some products. M.V. Sc. Thesis. Meat Hygiene, Fac. Vet. Med. Alex. Univ. in fast food with special reference to its enterotoxigenicity. Assiut Vet. Med. J. 54,112; 37-50.
ISO, 16649/2 (2001): Microbiology of Food and Animal Feeding Stuffs-Horizontal Method for the enumeration of beta - glucuronidase - positive E. coli: part 2: colony-count technique at 44ºC using 5-bromo -4-chloro-3-indoly beta-glucuronide
 ISO, 6579, (2002): Microbiology of Food and Animal Feeding Stuffs-Horizontal Method for the Detection of S. spp.
ISO, 6887/2 (2003): Microbiology of Food and Animal Feeding Stuffs-Preparation of Test Samples, Initial Suspension and Decimal Dilutions for Microb. Exam Egypt. J. Chem. Environ. Health, 1 (1):686-69 
Kaneko, K.; Hayashidani, H.; Ohtomo, Y.; Kosuge, J.; Kato, M.; Takahashi, K.; Shiraki, Y. and Ogauwa, M. (1999): Bacterialcontamination of ready to eat foods and fresh products in retail shops and food factories. J Food and Drug Analysis 1: 105-115.
Kozacinski, L.; Drosinos, E.; Caklovica, F.; Cocolin, L.; Gasparik-Reichandt, J. and Eskovic, S. (2008): Investigation of microbial association of traditionally fermented sausages. Food Technology and Biotechnology.46; 1,93-106.
Lee, A.; Smith, S.C. and Coloe, P.J. (1998): Survival and growth of Campylobacter jejuni after artificial inoculation onto chicken skin as a function of temperature and packaging conditions, J. Food Protection, 61: 1609-1614.
Li, Q.; Skyberg, J.A.; Fakhr, M.K.; Sherwood, J.S.; Molan, L.K. and logue, C.M. (2006): Antimicrobial susceptibility and characterization of Salmonella isolates from processed Bison carcass. APL Microbiol 72: 3046-3049.
Matossian, R. and Kingcott, E.W. (1979): The dona kebab a possible food poisoning hazard. Environm. Health. 86; 67-68.
Mehrotra, M.; Wang, G. and Johnson, M.W. (2000): Multiplex PCR for detection of genes for Staphylococcus aureus enterotoxin, exfoliative toxins, toxic shock syndrome toxin 1, and Methicillin resistance. Journal of Clinical Microbiology, Vol. 38: 1032-1035.
Motten, Vanessa; Fisch Elisa and Cardoso Marisa (2011): Microbial contamination of luncheon meat sliced and packaged in supermarkets in Porto Alegre, Brazil. Acta Scientiae Veterinariae, 39; 1: 940-945.
Mousa, M.M.; Awad, H.A.; Yassien, M.M. and Gouda, H.I. (1993): Microbial quality of some meat products.Vet. Med. J. Giza. 41; 3,59-62.
Murugkar, H.V.; Rahman, H. and Dutta, P.K. (2003): Distribution of virulence genes in Salmonella serovars isolated from man and animals. Indian J. Med. Res., 117:66-70.
Oh, S.K.; Lee, N.; Cho, Y.S.; Shin, D.B.; Choi, S.Y. and Koo, M. (2007): Occurrence of toxigenic Staph. Aureus in ready to eat food in Korea. J. Food Protection, 70; 1153-1158.
Oliveira, S.D.; Rodenbusch, C.R.; Ce, M.C.; Rocha, S.L.S. and Canal, C.W. (2003): Evaluation of selective and non-selective en-richment PCR procedures for Salmonella de-tection. Lett. Appl. Microbiol., 36: 217-221.
Osek, J. and Wieczorek, K. (2010): Zoonosis and their etiological agents in the EFSA report for 2008. ZycieWeterynaryjne. 2010. 85: 4, 315-324.
Pelczar, MJ.; Chane, CS. and Kreig, NR. (2006): Microbiology 5th edition. Tata McGraw-Hill Publishing Company Limited, New Delhi.
Puah, S.M.; Chua, K.H. and tan, J.A. (2016): virulence factor and antibiotic susceptibility of Staph. Aureus isolates in ready to eat foods: detection of Staph. aureus contamination and a high prevalence of virulence genes. Int. J. Environ Res public health 5; 13(2)199.
Saleh, E.A.; Ali, H.A. and Abu-Khadra, A.M. (2010): Detection of some food poisoning microorganisms in some meat products. Alex. J. Vet. Sc. 31; 1, 27-33.
Samaha, I.A.; Ibrahim, H.A.A. and Hamada, M.O. (2012): Isolation of some enteropathogens from retailed poultry meat in Alexandria Province. Alex. J. Vet. Science 37; 1:  17-22.
SAS Institute (2003): SAS Proprietary Software. Re. 9.1. SAS Instit. Inc. Cary, NC.
Shalaby, M. Amany and Zaki, M.S. Eman (2008): Occurrence of Staphylococcus aureus in fast food with special reference to its enterotoxigenicity. Assiut Vet. Med. J. 54,112: 37-50.
Shawish, R.R. and AL-Humam, N.A. (2016): Contamination of beef products with Staphylococcal classical enterotoxin in Egypt and Saudi Arabia. Hygiene and Infection Control, 11; ISSN 2196-5226.
Soultos, N.; Abrahim, A. and Abrosiadis, I. (2003): Incidence of some food borne bacterial pathogens in northern Greece. Archiv Staph. Furer Lebensmittel. Hygiene 54,(3);55-57.
Tharwat, A. Elsayed and Elabbasy, M. Tharwat (2014): Classical Staphylococcus aureus Enterotoxins genes in some chicken meat products marketed in Zagazig city, Egypt. The 1st International Conference on Impact of Environmental Hazards on Food Safety Faculty of Veterinary Medicine- Zagazig University, 20th August, 2014.
Tsang, O. (2002): Guidelines for Ready-To-Eat Food. Road and Environmental Hygiene Department, Hong Kong.pp.15 – 16
Tudor, L.; Togoe, I. and Mitranescu, E. (2010): The microbiological quality analysis of some meat products traded on Bucharest markets. Lucrari Stiintifice-Universitatea de Stiinte Agricole a Banatului Timisoara, Medicina Veterinara. 40; 688-693.                  
World Health Organization (WHO) (2013): MEDIA Centre, Fact sheet N°139: Salmonella (non-typhoidal), Available at: http://www.who. nt/ media centre/ factsheets/fs139/en.