MOLECULAR CHARACTERIZATION OF STAPH. AUREUS AND SOME ENTERIC BACTERIA PRODUCING TOXINS IN MINCED MEAT SOLED IN PORT-SAID CITY MARKETS

Document Type : Research article

Authors

1 Department of Bacteriology, Animal Health Research Institute, Port-Said Branch

2 Department of Food Hygiene, Animal Health Research Institute, Port-Said Branch

Abstract

A total of 100 minced meat samples were collected from different butchers in Port-Said city for isolation and identification of Staph. aureus, Escherichia coli and Salmonella spp.. The results revealed that Staph. aureus, E. coli and Salmonella spp. could be detected in a percentage of 14%, 12% and 1% respectively from minced meat samples. Molecular characterizations of all isolated S. aureus, E. coli and Salmonella spp. were confirmed using 16S rRNA, phoA and invA, respectively by conventional PCR at 791 bp; 720 bp and 284 bp, respectively. Multiplex PCR was developed with specific primers for the detection of different enterotoxin genes (Sea, Seb, Sec, Sed and See) of Staph. aureus, (Stx1, Stx2, STa and lt) of E. coli and (stn) of Salmonella which may be considered a significant in food safety threat. The obtained results showed that the positive serotypes for enterotoxin genes were (Seb in 3 isolates and Sed in one isolate) of Staph. aureus at 164 bp and 278 bp respectively; (Stx2 in 2 isolates and STa in 2 isolates) of E. coli at 779 bp and 229 bp, respectively. Conventional PCR is rapid methods for the confirmation of Staph. aureus, E. coli and Salmonella spp., while multiplex PCR is a useful technique for detection of enterotoxin genes. The public health hazards of this isolated organism, as well as recommended measures to improve quality status of minced meat were discussed.

Keywords


Assiut University web-site: www.aun.edu.eg

 

MOLECULAR CHARACTERIZATION OF STAPH. AUREUS AND SOME ENTERIC BACTERIA PRODUCING TOXINS IN MINCED MEAT SOLED IN

PORT-SAID CITY MARKETS

 

GIHAN M.O. MOHAMMED1 and HANAN A. EL DAHSHAN2

1 Department of Bacteriology, Animal Health Research Institute, Port-Said Branch

2 Department of Food Hygiene, Animal Health Research Institute, Port-Said Branch

 

Received: 24 August 2016;           Accepted:  9 October 2016

 

 

ABSTRACT

 

A total of 100 minced meat samples were collected from different butchers in Port-Said city for isolation and identification of Staph. aureus, Escherichia coli and Salmonella spp.. The results revealed that Staph. aureus, E. coli and Salmonella spp. could be detected in a percentage of 14%, 12% and 1% respectively from minced meat samples. Molecular characterizations of all isolated S. aureus, E. coli and Salmonella spp. were confirmed using 16S rRNA, phoA and invA, respectively by conventional PCR at 791 bp; 720 bp and 284 bp, respectively. Multiplex PCR was developed with specific primers for the detection of different enterotoxin genes (Sea, Seb, Sec, Sed and See) of Staph. aureus, (Stx1, Stx2, STa and lt) of E. coli and (stn) of Salmonella which may be considered a significant in food safety threat. The obtained results showed that the positive serotypes for enterotoxin genes were (Seb in 3 isolates and Sed in one isolate) of Staph. aureus at 164 bp and 278 bp respectively; (Stx2 in 2 isolates and STa in 2 isolates) of E. coli at 779 bp and 229 bp, respectively. Conventional PCR is rapid methods for the confirmation of Staph. aureus, E. coli and Salmonella spp., while multiplex PCR is a useful technique for detection of enterotoxin genes. The public health hazards of this isolated organism, as well as recommended measures to improve quality status of minced meat were discussed.

 

Key words: Staph. aureus, E. coli and Salmonella spp., PCR, enterotoxin genes, minced meat.

 

 


INTRODUCTION

 

Minced meat that has been minced into fragments and contains less than 1% salt. Minced meat has an important role in human nutrition as they are desirable foodstuff (Biesalski, 2005). In a whole cut from an animal, the interior of the meat is essentially sterile, even before cooking; any bacterial contamination is on the outer surface of the meat. When meat is ground, bacterial contamination from the surface can be distributed throughout the meat. If ground beef is not well cooked all the way through, there is a significant chance that enough pathogenic bacteria will survive to cause illness. Food-borne illness is a major international health problem (Mensah et al., 2002 and Ayten et al., 2014).

 

Food-borne diseases coming from pathogenic bacteria have been of vital concern to public health. Staph. aureus;  E. coli  and  Salmonella  spp.  are considered more frequent human pathogens. They are often simultaneously found in some contaminated food matrices, such as meat products (Leclerc et al., 2002). E. coli,  is  generally  used  as  an  indicator  of   fecal

 

 
   

 

 


Corresponding author: Dr. GIHAN M.O. MOHAMMED

E-mail address: dr.gehanomer@yahoo.com

Present address: Department of Bacteriology, Animal Health Research Institute, Port-Said Branch

 

pollution and some strains may cause severe diseases (Ahmed et al., 2007). Salmonella spp. and Staph. aureus remains a major cause of morbidity and mortality worldwide (Threlfall 2008 and Schreiber et al., 2011). Each year, millions of persons become ill from food-borne diseases, though many cases are not reported Centers for Disease Control and Prevention (1997). If you’re getting mince from a butcher, it’s likely to be made from cheaper cuts like chuck steak, from the front shoulders of the cow, and thin flank from the cow’s belly. It will also probably include trimmings of meat from steaks, roasting joints and others. The butchers will also make sure that there’s a percentage of fat in the mince because it needs a certain amount to give it moisture and flavor as it cooks. Food-borne pathogens such as bacteria or their toxins may lead to human disease when contaminated food is eaten. The source of contamination may vary but harmful bacteria are mostly responsible for causing gastrointestinal infections (Scallan et al., 2011). Food-borne illnesses and intoxications can occur due to the presence of certain bacteria such as Staph. aureus, E. coli and Salmonella spp. (Elmalıand Yaman 2005 and Tachbele et al., 2006). Microbial quality of minced meat as one of meat products plays an important role in increasing public health issue all over the world. During the last decades, there was a great improvement in hygienic technique for production of meat products with attention of a lot of consumers towards healthy nutrition Ahmedand Ismail, (2010).

 

Molecular detection methods based on PCR are increasingly accepted as alternatives to conventional cultural/ biochemical methods for the detection of bacterial contamination in food (De Boer and Beumer, 1999). PCR technique is considered as a sensitive detection method for specific pathogens. Multiplex PCR assay seems to be a useful technique for rapid and specific detection of pathogens in food and has been used for the control and prevention of food-borne epidemics (Kawasaki et al., 2009).

 

Due to the progressive increase in the incidence of food borne infections, there is an urgent need for control and/or prophylaxis for food poisoning outbreaks associated with meat products. It depends greatly on investigating the causative agents in mincedmeat, eliminating them to ensure food safety and to protect public health from microbial contamination. The aim of the current study was to determine the bacteriolological quality of minced meat obtained from different butchers in Port-Said city through determine the incidence of Staph. aureus, E. coli and Salmonella spp. with regarding to the public health as well as confirmed and determined some virulence genes by using PCR technique.

 

MATERIALS AND METHODS

 

1- Samples collection: One hundred samples of minced meat were randomly collected from different butchers in Port- Said city. Each sample was aseptically transported in ice-box to laboratory quicklyas soon as possible for detection of Staph. aureus, E.coli and Salmonella spp.

 

2. Bacteriological examination:

2.1- Isolation and Identification of Staph. aureus: Isolation of Staph. aureus was attempted according to ISO (1999). 10 gram of sample was homogenized with 90 ml sterile enrichment broth peptone water and enriched for 24 hrs at 37 °C. A loopful of inoculum from enrichment broth was streaked on Baird Parker Agar (BPA) and incubated for 48 hours at 37°C. Characteristic appearance of jet black colonies surrounded by a white halo was considered to be presumptive Staph. aureus. The pure cultures were streaked on Nutrient agar, incubated for 24 hours at 37°C for further characterized.

 

2.1.1- Morphological characteristics of Staph. aureus: The smear was prepared from the isolated culture and stained with Gram's stain. The stained smear revealed Gram positive, spherical cells arranged in irregular clusters resembling to bunch of grapes according to Cruickshank et al. (1975).

 

2.1.2- Biochemical examination: The biochemical tests were performed to confirm Staph. aureus using Catalase test, Coagulase test, DNase test, Acetoin production, Oxidase test and D-mannitol fermentation according to Thaker et al. (2013).

 

2.2- Isolation and Identification of E. coli: Isolation of E. coli was attempted according to Qunin et al. (2002). 10 gram of sample was homogenized with 90 ml sterile enrichment broth peptone water and incubated for 24 hrs at 37°C. A loopful from inoculated broth was streaked on the surface of Eosin methylene blue agar plate. Inoculated plate was incubated at 37°C for 24- 48hr. The pure cultures were streaked on Nutrient agar and were incubated for 24 hours at 37°C for further characterized.

 

2.2.1- Morphological characteristics of E. coli: according to (Qunin et al., 2002).

 

2.2.2- Biochemical examination: The biochemical tests of E. coli using Oxidase test, Indole production, Methyl red, Voges Proskauer test, Utilization of citrate, hydrogen sulfide production on Triple Sugar Iron agar (TSI), Hydrolysis of urea and Sugar fermentation test according to (Qunin et al., 2002).

 

2.3-Isolation and Identification of Salmonella spp.:

Isolation of Salmonella spp. was attempted according to ISO (2002).

 

2.3.1- Morphological characteristics of Salmonella spp.: according to (Qunin et al., 2002).

 

2.3.2-Biochemical examination: The biochemical tests were performed to confirm E. coli using Oxidase test, hydrogen sulfide production on Triple Sugar Iron agar (TSI), Hydrolysis of urea and Lysine iron agar according to (Qunin et al., 2002).

 

3. Molecular characterization and detection of Staph. aureus, E. coli and Salmonella spp. enterotoxins genes:

The Staph. aureus, E. coli and Salmonella spp. isolated from minced meat samples were confirmed by PCR using (16S rDNA of Staph. aureus), (phoA of E. coli) and (invA of Salmonella spp.), also determining some enterotoxins genes using  specific primers (Sea, Seb, Sec, See and Sed) for Staph. aureus, (Stx1, Stx2, STa and lt) for E. coli and (stn) for  Salmonella spp.

 

3.1-DNA extraction: DNA extraction from samples was performed using the QIAamp DNA Mini kit (Qiagen, Germany, GmbH) with modifications from the manufacturer’s recommendations. Briefly, 200 µl of the sample suspension was incubated with 10 µl of proteinase K and 200 µl of lysis buffer at 56OC for 10 min. After incubation, 200 µl of 100% ethanol was added to the lysate. The sample was then washed and centrifuged following the manufacturer’s recommendations. Nucleic acid was eluted with 150 µl of elution buffer provided in the kit.


 

3.2-Oligonucleotide Primer: Primers are listed in table (1).


 

Table 1: Primers sequences, target genes, amplicon sizes and cycling conditions.

 

Target gene

Primers sequences

Amplified segment (bp)

Primary

denaturation

Amplification (35 cycles)

Final extension

Reference

Secondar denaturation

Annealing

Extension

Staphylococcus

 Sea

GGTTATCAATGTGCGGGTGG

102

94˚C

5 min.

 

 

94˚C

30 sec.

 

 

50˚C

45 sec.

 

 

72˚C

45 sec.

 

 

72˚C

10 min.

 

Mehrotra et al., (2000)

CGGCACTTTTTTCTCTTCGG

Seb

GTATGGTGGTGTAACTGAGC

164

CCAAATAGTGACGAGTTAGG

 Sec

AGATGAAGTAGTTGATGTGTATGG

451

CACACTTTTAGAATCAACCG

Sed

CCAATAATAGGAGAAAATAAAAG

278

ATTGGTATTTTTTTTCGTTC

See

AGGTTTTTTCACAGGTCATCC

209

CTTTTTTTTCTTCGGTCAATC

Staphylococcus

16S rRNA

 

CCTATAAGACTGGGATAACTTCGGG

791

94˚C

5 min.

94˚C

30 sec.

55˚C

45 sec.

72˚C

45sec.

72˚C

10 min.

Mason et al., (2001)

 

CTTTGAGTTTCAACCTTGCGGTCG

E. coli

Stx1

ACACTGGATGATCTCAGTGG

614

94˚C

5 min.

 

 

94˚C

30 sec.

58˚C

45 sec.

72˚C

45sec.

72˚C

10 min.

Dipinetoet al., (2006)

CTGAATCCCCCTCCATTATG

 

Stx2

CCATGACAACGGACAGCAGTT

779

CCTGTCAACTGAGCAGCACTTTG

STa

GAAACAACATGACGGGAGGT

229

94˚C

5 min.

 

 

94˚C

30 sec.

57˚C

45 sec.

72˚C

45sec.

72˚C

10 min.

Leeet al., (2008)

GCACAGGCAGGATTACAACA

LT

GGTTTCTGCGTTAGGTGGAA

605

GGGACTTCGACCTGAAATGT

E. coli phoA

CGATTCTGGAAATGGCAAAAG

720

94˚C

5 min.

94˚C

30 sec.

58˚C

40 sec.

72˚C

45 sec.

72˚C

10 min.

Hu et al. (2011)

 

CGTGATCAGCGGTGACTATGAC

Salmonella

Stn

TTG TGT CGC TAT CAC TGG CAA CC

617

94˚C

5 min.

94˚C

30 sec.

59˚C

45 sec.

72˚C

45 sec.

72˚C

10 min.

Murugkaret al. (2003)

ATT CGT AAC CCG CTC TCG TCC

Salmonella

invA

GTGAAATTATCGCCACGTTCGGGCAA

284

94˚C

5 min.

94˚C

30 sec.

55˚C

30 sec

72˚C

30 sec

72˚C

7 min.

Oliveira et al. (2003)

TCATCGCACCGTCAAAGGAACC


3.3-PCR amplification: Primers were utilized in a 25- µl reaction containing 12.5 µl of Emerald Amp Max PCR Master Mix (Takara, Japan), 1 µl of each primer of 20 pmol concentrations, 4.5 µl of water, and 6 µl of DNA template. The reaction was performed in an applied biosystem 2720 thermal cycler. For multiplex PCR of enterotoxins, Primers were utilized in a 50- µl reaction containing 25 µl of Emerald Amp Max PCR Master Mix (Takara, Japan), 1 µl of each primer of 20 pmol concentrations, 5 µl of water, and 10 µl of DNA template. For dultiplex PCR of E. coli virulence genes (stx1 and stx2) or (STa and LT), Primers were utilized in a 50- µl reaction containing 25 µl of Emerald Amp Max PCR Master Mix (Takara, Japan), 1 µl of each primer of 20 pmolconcentration, 11 µl of water, and 10 µl of DNA template.

 

3.4-Analysis of the PCR Products: The products of PCR were separated by electrophoresis on 1.5% agarose gel in 1x TBE buffer at room temperature using gradients of 5V/cm. For gel analysis, 20 µl of the uniplex PCR products and 40 µl of the multiplex PCR products were loaded in each gel slot. Gelpilot 100 bp plus DNA Ladder (Qiagen, Germany, GmbH) and generuler 100 bpladder were used to determine the fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra) and the data was analyzed through computer software.

 

 

RESULTS

 

Table 2: Prevalence of Staph. aureus, E. coli and Salmonella spp. in mincedmeat samples (n=100).

 

isolated organisms

No.

%

Staph. aureus

14

14%

E. coli

12

12%

Salmonella

1

1%

 

Table 3: Molecular characterization and some enterotoxin genes of Staph.aureus isolated from minced meat samples.

 

No. of tested  isolates

16S rRNA

enterotoxin genes

Sea

Seb

Sec

Sed

See

No.

%

No.

%

No.

%

No.

%

No.

%

No.

%

 

 

 

 

 

 

 

 

 

 

 

 

 

14

14

100

-

0.0

3

21.4

-

0.0

1

7.1

-

0.0

 

 

 

 
 

Fig (1)

ig (1)

 

 

 

 

 

 

 


 

 

Fig. (1) & Fig. (2): Agarose gel electrophoresis of PCR prod­ucts after amplification of:

1- Staph. aureus 16Sr DNA gene. MWM-molec­ular weight marker (100 – 1500 bp DNA ladder), + control (Positive, Negative) + different strains of Staph. aureus (Staph. aureus16Sr DNA gene products at 791bp).

2- Seagene (Sea gene products at 102 bp).   3- Seb gene (Seb gene products at 164 bp).

4- Secgene (Sec gene products at 451 bp).   5- See gene (Sec gene products at 209 bp).

6- Sed gene (Sed gene products at 278 bp).

 

 

Table 4: Molecular characterization and some virulence genes of E. coli isolated from minced meat samples.

 

No. of tested isolates

phoA

Enterotoxin genes

Stx1

Stx2

STa

lt

No.

%

No.

%

No.

%

No.

%

No.

%

12

12

100

-

0.0

2

16.6

2

16.6

-

0.0

 

 

 

 

 

 

 

 

 

 

Fig. (3) & (4) & (5): Agarose gel electrophoresis of PCR prod­ucts after amplification of:

1- E.coli PhoA gene. MWM-molec­ular weight marker (100 – 1500 bp DNA ladder), + control (Positive, Negative) + different strains of E.coli (E.coli PhoA gene products at 720bp).

2- Sta gene (Sta gene products at 229 bp).     3-LT gene (LT gene products at 605 bp).

4- Stx1 gene (Stx1gene products at 614 bp).  5- Stx2 gene (Stx2 gene products at 779 bp).

 

Table 5: Molecular characterization and some virulence genes of Salmonella Spp. Isolated from minced meat samples.

 

No. of tested isolates

invA

Enterotoxin genes

stn

No.

%

No.

%

1

1

100

-

0.0

 

 

 

 

 

Fig (6): Agarose gel electrophoresis of PCR prod­ucts after amplification of:

1-    Salmonella spp. InvA gene. MWM-molec­ular weight marker (100 – 1000 bp DNA ladder), + control (Positive, Negative) + different strains of Salmonella (Salmonella spp. invA gene products at 284bp).

2-    Stngene (stn gene products at 617 bp).

 


DISCUSSION

 

The present work was made in order to evaluate the prevalence of Staph. aureus, E. coli and Salmonella spp. among minced meat, also to confirm the isolated microbes and determined some enterotoxins genes characteristics of Staph. aureus, E. coli and Salmonella spp. using conventional PCR and multiplex PCR. So, a total of 100 minced meat samples showed bacterial contamination with species of the genera, Staph. aureus, E. coli and Salmonella spp. in percentages of 14 %, 12% and 1%, respectively in (Table 2). The presence of these isolates in the higher percentage in minced meat samples collected from different butchers in Port-Said city is an indication of unsatisfactory handling of minced meat and inadequate hygiene. Higher results were recorded by Sarah, (2014); Ezzat et al. (2014) and Raafat et al. (2011). The later isolated Staph. aureus, E. coli and Salmonella spp. in a percentages of  80 %, 28% and 20%, respectively from minced meat. The prevalence of S. aureus in different food products ranged from 5% to 100% (Adwan et al., 2005; Vázquez-Sánchez et al., 2012). The difference in the results may be attributed to difference in sampling procedure, locality, number of samples and difference in method used. Butthe prevalence of E. coli in different food ranged from 11% to 100% (Zhao et al., 2001; Ukut et al., 2010; Abdellah et al., 2013; Iyeret al., 2013 and Adeyanju and Ishola, 2014). While the prevalence of Salmonella in different food products ranged from 2% to 100% (Cohen et al., 2007; Aftab et al., 2012; Iyer et al., 2013; Anihouvi et al., 2013; Adeyanju and Ishola, 2014).

 

Biochemical identified Staph. aureus, E. coli and Salmonella spp. (14, 12 and 1isolates, respectively) were submitted for molecular characterizations and confirmed by using (16S rRNA of Staph. aureus), (phoA of E. coli) and (invA of Salmonella spp.) by conventional PCR. The results proved that the isolates were Positive Staph. aureus (14 isolates), E. coli (12 isolates) and (one isolates) Salmonella spp. as recorded in tables (3, 4 and 5) and figures (1, 2, 3, 4 and 6). These results were agreement with those obtained by the conventional PCR assay with respective primers 16S rRNA of Staph. aureus), (phoA of E. coli) and (invA of Salmonella spp.), suggesting PCR was able to confirm the Staph. aureus, E. coli and Salmonella infection (Manson et al., 2001; Hu et al., 2011 and Oliveira et al., 2003).

 

Determination of some enterotoxin genes (Sea, Seb, Sec, Seeand Sed) of Staph. aureus, (Stx1, Stx2, STa and lt) of E. coli and (stn) of Salmonella spp. isolated from minced meat samples by multiplex PCR. Tables (3, 4 and 5) Figures (2 and 5) showed the positive serotypes for enterotoxin genes (Seb in 3 isolates and Sed in one isolate) of S. aureus; (Stx2 in 2 isolates and STa in 2 isolates) of E. coli. None of the samples were positive for (Sea, Sec and See) of S. aureus, (Stx1 and lt) of E. coli and (stn) of Salmonella spp. These results were in agreement with those obtained by the multiplex PCR assay with respective primers (Sea, Seb, Sec, See and Sed) of S. aureus, (Stx1, Stx2, STa and lt) of E. coli and (stn) of Salmonella spp. (Mehrotra et al., 2000; Dipineto et al., 2006 and Lee et al., 2011 and Murugkar et al., 2003).

 

The negative results in PCR may be attributed to PCR based detection mainly depends on the purity and amount of the template DNA used (Estrada et al., 2007). The presence of PCR inhibitors in food samples and incomplete bacterial cell isolation lead to the production of false negative results in PCR based detection and the removal of PCR inhibitors, efficient bacterial cell isolation and efficient DNA extraction is important (Jeníkova et al., 2000). The variation in the presence of enterotoxin genes among different serotypes isolated from different sources of minced meat samples revealed that the mechanisms of pathogenesis depends mainly on the presence of different virulence factors not to the different serotypes. S. aureus, E. coli and Salmonella spp. from different food samples in different studies could be due in part to several factors including: differences in the reservoir, ecological origin of pathogenic strains, sensitivity of detection methods, detected genes, number of samples, type of sample, time of sampling and storage conditions (Zhao et al., 2001 and Adwan et al., 2005). 

 

CONCLUSION AND RECOMMENDATION

 

From the obtained results, it can concluded that contamination by Staph. aureus, E. coli and Salmonella spp. were found in minced meat samples collected from different butchers in Port-Said city. The following suggestive measures should be considered to keep the examined products free from pathogens as possible:

 

- Routine microbiological examination should be adopted in minced meat factories, butchers shops, groceries and other food rendering outlet with a consequent certificate of nil presence food born bacteria.

 

- Hygienic awareness should be applied for personnel whom involved in handling and preparing of food at factories, home or restaurants.

 

- Careful handling and thorough cooking of minced meat, regardless of market source by the consumers is required to prevent food borne illness.

 

- Conventional and multiplex PCR is required as rapid, accurate and specific tool for isolated confirmation of isolated Staph. aureus, E. coli and Salmonella spp. and of detection of their enterotoxin genes.

 

REFERENCES

 

Abdellah, E.; Fouzia, R.F. and Bouchra, O. (2013): Prevalence and antibiogram study of Escherichia coli and Staphylococcus aureus in turkey meat in Morocco. Pharmaceutica Analytica Acta 4(9): 270.

Adeyanju, G.T. and Ishola, O. (2014): Salmonella and Escherichia coli contamination of poultry meat from a processing plant and retail markets in Ibadan, Oyo State, Nigeria. Springer Plus 3: 139.

Adwan, G.; Abu-Shanab, B. and Adwan, K. (2005): Enterotoxigenic Staphylococcus aureus inraw milk in the North of Palestine. Turkish Journal of Biology 29: 229-232.

Aftab, M.; Rahman, A.M.; Qureshi, M.S.; Akhter, S.; Sadique, U.; Sajid, U. and Zaman, S. (2012): Level of Salmonella in beef of slaughtered cattle at Peshawar. Journal of Animal and Plant Sciences 22(2): 24-27.

Ahmed, A.M. and Ismail, T.H. (2010): Improvement of the quality and shelf-life of minced beef mixed with soy protien by Sage (Saliva of ficinalis). African Journal of Food Science, 4: 330-334.

Ahmed, W.; Tucker, J.; Bettelheim, KA.; Neller, R. and Katouli, M. (2007): Detection of virulence genes in Escherichia coli of an existing metabolic fingerprint database to predict the sources of pathogenic E. coli in surface waters. Water Res; 41:3785–91.

Anihouvi, D.G.H.; KAyodé, A.P.P.; Anihouvi, V.B.; Azokpota, P.; Kotchoni, S.O. and Hounhouigan, D.J. (2013): Microbial contamination associated with the processing of tchachanga, a roasted meat product. African Journal of Biotechnology 12(18): 2449-2455.

Aytenkimiran erdem1 duygu saglam2 didemozer 2 ezgiozcelik (2014): Microbiological quality of minced meat samples marketed in is tan bul. Veteriner fakultes idergisi; 25 (3), 67-70.

Biesalski, H.K. (2005): Meat as a component of a healthy diet. Are there any risks or benefits if meat is avoided in the diet. Meat Science; 70: 509-524.

Centers for Disease Control and Prevention (CDC) (1997): The Food-borne diseases active surveillance network, 1996. Morbidity and Mortality Weekly Report, 46: 258–261.

Cohen, N.; Ennaji, H.; Bouchrif, B.; Hassar, M. and Karib, H. (2007): Comparative study of microbiological quality of raw poultry meat at various seasons and for different slaughtering processes in Casablanca (Morocco). The Journal of Applied Poultry Research 16: 502–508.

Cruickshank, R.; Duguid, J.P.; Marmion, B.P. and Swain, R.H.A. (1975): Medical Microbiology, 12th ed., vol. II. Churchill Livingstone, Edinburg, London and New York.

De Boer, E. and Beumer, R.R. (1999): Methodology for detection and typing of foodborne microorganisms. International Journal of Food Microbiology 50: 119–130.

Dipineto, L.; Santaniello, A.; Fontanella, M.; Lagos, K.; Fioretti, A. and Menna, L.F. (2006): Presence of Shiga toxin-producing Escherichia coli O157:H7 in living layer hens. Letters in Applied Microbiology 43 (2006) 293–295.

Elmalı, M. and Yaman, H. (2005): Microbiological quality of raw meat balls: produced and sold in the eastern of Turkey. Pakistan. J. Nutr, 4 (4), 197–201.

Estrada, C.S.; Velasquez, L.D., Genaro, S.D. and Guzman, A.M. (2007): Comparison of DNA extraction methods for pathogenic Yersinia enterocolitica detection from meat food by nested PCR. Food Res. Inter., 40: 637–642.

Ezzat, M.E.; Zaki, E.M.S.; Mohammed, G.M.O. and Rabie, M.A. (2014): Molecular characterization of pathogenic E. coli isolated from meat and their products. Suez Canal Veterinary Medicine Journal, XIX(1):103-113.

Hu, Q.; Tu, J.; Han, X.; Zhu, Y.; Ding, C. and Yu, S. (2011): Development of multiplex PCR assay for rapid detection of Riemerella anatipestifer, Escherichia coli, and Salmonella enterica simultaneously from ducks. Journal of Microbiological Methods 87: 64–69.

ISO (1999): Microbiology of food and animal feeding stuffs – Horizontal method for the enumeration of coagulase-positive staphylococci (Staphylococcus aureus and other species) - Technique using rabbit plasma fibrinogen agar medium. International Standard ISO 6888-2, International Organization for Standardization, Geneva.

ISO (2002): Microbiology of food and animal feeding stuffs-Horizontal method for detection of Salmonella spp. ISO 6579 Organisation for Standardization.

Iyer, A.; Kumosani, T.; Yaghmoor, S.; Barbour, E.; Azhar, E. and Harakeh, S. (2013): Escherichia coli and Salmonella spp. in meat in Jeddah, Saudi Arabia. Journal of Infection in Developing Countries 7(11): 812-818.

Jeníkova, G.; Pazlarova, J. and Demnerova, K. (2000): Detection of Salmonella in food samples by the combination of immunomagnetic separation and PCR assay. Inter. J. Microbiol., 3:225–229.

Kawasaki, S.; Fratamico, P.M.; Horikoshi, N.; Okada, Y.; Takeshita, K.; Sameshima, T. and Kawamoto, S. (2009): Evaluation of a multiplex PCR system for simultaneous detection of Salmonella spp., Listeria monocytogenes, and Escherichia coli O157:H7 in foods and in food subjected to freezing. Foodborne Pathogens and Disease 6(1): 81-89.

Leclerc, V.; Dufour, B.; Lombard, B.; Gauchard, F.; Garin-Bastuji, B. and Salvat, G. (2002): Pathogens in meat and milk products: surveillance and impact on human health in France. Livest Prod Sci; 76: 195–202.

Lee, S.I.; Kang, S.G.; Kang, M.L. and Yoo, H.S. (2008): Development of multiplex polymerase chain reaction assays for detecting enterotoxigenic Escherichia coli and their application to field isolates from piglets with diarrhea. J Vet Diagn Invest 20:492–496.

Mason, W.J.; Blevins, J.S.; Beenken, K.; Wibowo, N.; Ojha, N. and Smeltzer, M.S. (2001): Multiplex PCR protocol for the diagnosis of staphylococcal infection. Journal of clinical microbiology, 39(9): 3332–3338.

Mehrotra, M.; Wang, G. and Johnson, W.M. (2000): Multiplex PCR for Detection of Genes for Staphylococcus aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin Resistance. Journal of Clinical Microbiology; 38(3).

Mensah, P.; Yeboah-Manu, D.; Owusu-Darko, K.; and Ablordey, A. (2002): Street foods in Accra, Ghana: how safe are they? Bulletin of the World Health Organization, 80: 546–553.

Murugkar, H.V.; Rahman, H. and Dutta, P.K. (2003): Distribution of virulence genes in Salmonella serovars isolated from man and animals. Indian J Med Res., 117:66-70.

Olivera, S.D.; Rodenbusch, C.R.; Ce, M.C.; Rocha, S.L.S. and Canal, C.W. (2003): Evaluation of selective and non selective en-richment PCR procedures for Salmonella de-tection. Lett. Appl. Microbiol., 36: 217-221.

Quinn, p.; Markey, B.; Carter, M.; Donelly, W. and Leonard, F. (2002): Veterinary microbiology, Microbial Disease. Black Well Science: 26-36.

Raafat, H.; Sohaila, F.H.A.; Ashraf, M.A.; Moemen, A.M and Khalid, I.E. (2011): Detection and identification of Salmonella species in minced beef and chicken meats by using Multiplex PCR in Assiut city. Veterinary World, 4 (1): 5-11.

Sarah, M.M.A. (2014):Molecular characterization of Staphylococcus aureus isolated from meat, milk and their products. M.V. Sc. Thesis, (Bacteriology, Immunology and Mycology) Faculty of Veterinary Medicine. Suez Canal University.

Scallan, E.; Griffin, P.M.; Angulo, F.J.; Tauxe, R.V. and Hoekstra, R.M. (2011): Foodborne illness acquired in the United States–unspecified agents. Emerg Infect Dis.17:16–27.

Schreiber, M.P.; Chan, C.M. and Shorr, A.F. (2011): Bacteremia in Staphylococcus aureus pneumonia: outcomes and epidemiology. J. Crit Care; 26: 395–401.

Tachbele, E.; Erku, W.; Gebre-Michael, T. and Ashenafi, M. (2006): Cockroach-associated food-borne bacterial pathogens from some hospitals and restaurants in Addis Ababa, Ethiopia: Distribution and antibiograms. J Rural Trop Public Health, 5, 34–41.

Thaker, H.C.; Brahmbhatt, M.N. and Nayak, J.B. (2013): Isolation and identification of Staphylococcus aureus from milk and milk products and their drug resistance patterns in Anand, Gujarat. Vet. World, 6 (1): 10-13.

Threlfall, E.J. (2008): Salmonella. In: Heggenhougen K, Quah S, editors. International encyclopedia of public health. Amsterdam: Elsevier: 639–47.

Ukut, O.E.; Okonko, I.O.; Ikpoh, I.S.; Nkang, A.O.; Udeze, A.O.; Babalola, T.A.; Mejeha, O.K. and Fajobi, E.A. (2010): Assessment of bacteriological quality of fresh meats sold in Calabar metropolis, Nigeria. Electronic Journal of Environmental, Agricultural and Food Chemistry 9(1): 89-100.

Vázquez-Sánchez, D.; López-Cabo, M.; Saá-Ibusquiza, P. and Rodríguez-Herrera, J.J. (2012): Incidence and characterization of Staphylococcus aureusin fishery products marketed in Galicia (Northwest Spain). International Journal of Food Microbiology 157(2): 286-296.

Zhao, C.; Ge, B.; De Villena, J.; Sudler, R.; Yeh, E.; Zhao, S.; White, D.G.; Wagner, D. and Meng, J. (2001): Prevalence of Campylobacter spp., Escherichia coli, and Salmonella serovars in retail chicken, turkey, pork, and beef from the Greater Washington, D.C., area. Applied and Environmental Microbiology 67(12): 5431-5436.

 

 

 

 

التوصيف الجزيئي لميکروب العنقودي الذهبي وبعض الميکروبات المعوية المنتجة للسموم

في اللحوم المفرومة بأسواق مدينة بورسعيد المباعة

 

جيهان محمد عمر محمد ، حنان أمين مصطفى الدهشان

 

Email: dr.gehanomer@yahoo.com      Assiut University web-site: www.aun.edu.eg

 

 

في هذه الدراسة تم تجميع 100 عينة من اللحم المفروم المباعة في محلات الجزارة المختلفة بمدينة بورسعيد عشوائيا  للکشف عن مدى تواجد الميکروب العنقودي الذهبي والايشيريشيا القولونية والسالمونيلا. وأظهرت نتائج الفحص البکتريولوجي والتعريف البيوکيميائي أن الميکروبات تم عزلها بنسبة 14%، 12% و 1% من العينات موضع الفحص علي التوالي. وباستخدام اختبار البلمرة المتسلسل(PCR)  للتأکد من العترات المعزولة وذلک باستخدام(16S rRNA)  لميکروب العنقودي الذهبي و (phoA) لميکروب الايشيريشيا القولونية و(invA) لميکروب السالمونيلا والذي اعطى نتائج ايجابية بنسبة100 %. وأيضا باستخدام (multiplex PCR) لتحديد جينات السموم (Sea, Seb, Sec, Sed and See) لميکروب العنقودي الذهبي و (Stx1, Stx2, STa , lt) لميکروب الايشيريشيا القولونية و (stn) لميکروب السالمونيلا، کشفت النتائج عن وجود کل من ( Sed في عترة  و Seb في 3 عترات لميکروب العنقودي الذهبي ، بينما تم تحديد (  Stx2في عترتين وSTa في عترتين لميکروب الايشيريشيا القولونية(. مما يدل ان تقنية PCR طريقة سريعة تشخيصيه للتحري عن تواجد الميکروب العنقودي الذهبي والايشيريشيا القولونية والسالمونيلا. وقد تم مناقشة النتائج وبيان أهمية الميکروبات المعزولة وخطورتها علي الصحة العامة للمستهلک وعمل التوصيات للتقليل من مخاطرها.

 

 

       
 

100 bp

 
 

1500

 
REFERENCES
 
Abdellah, E.; Fouzia, R.F. and Bouchra, O. (2013): Prevalence and antibiogram study of Escherichia coli and Staphylococcus aureus in turkey meat in Morocco. Pharmaceutica Analytica Acta 4(9): 270.
Adeyanju, G.T. and Ishola, O. (2014): Salmonella and Escherichia coli contamination of poultry meat from a processing plant and retail markets in Ibadan, Oyo State, Nigeria. Springer Plus 3: 139.
Adwan, G.; Abu-Shanab, B. and Adwan, K. (2005): Enterotoxigenic Staphylococcus aureus inraw milk in the North of Palestine. Turkish Journal of Biology 29: 229-232.
Aftab, M.; Rahman, A.M.; Qureshi, M.S.; Akhter, S.; Sadique, U.; Sajid, U. and Zaman, S. (2012): Level of Salmonella in beef of slaughtered cattle at Peshawar. Journal of Animal and Plant Sciences 22(2): 24-27.
Ahmed, A.M. and Ismail, T.H. (2010): Improvement of the quality and shelf-life of minced beef mixed with soy protien by Sage (Saliva of ficinalis). African Journal of Food Science, 4: 330-334.
Ahmed, W.; Tucker, J.; Bettelheim, KA.; Neller, R. and Katouli, M. (2007): Detection of virulence genes in Escherichia coli of an existing metabolic fingerprint database to predict the sources of pathogenic E. coli in surface waters. Water Res; 41:3785–91.
Anihouvi, D.G.H.; KAyodé, A.P.P.; Anihouvi, V.B.; Azokpota, P.; Kotchoni, S.O. and Hounhouigan, D.J. (2013): Microbial contamination associated with the processing of tchachanga, a roasted meat product. African Journal of Biotechnology 12(18): 2449-2455.
Aytenkimiran erdem1 duygu saglam2 didemozer 2 ezgiozcelik (2014): Microbiological quality of minced meat samples marketed in is tan bul. Veteriner fakultes idergisi; 25 (3), 67-70.
Biesalski, H.K. (2005): Meat as a component of a healthy diet. Are there any risks or benefits if meat is avoided in the diet. Meat Science; 70: 509-524.
Centers for Disease Control and Prevention (CDC) (1997): The Food-borne diseases active surveillance network, 1996. Morbidity and Mortality Weekly Report, 46: 258–261.
Cohen, N.; Ennaji, H.; Bouchrif, B.; Hassar, M. and Karib, H. (2007): Comparative study of microbiological quality of raw poultry meat at various seasons and for different slaughtering processes in Casablanca (Morocco). The Journal of Applied Poultry Research 16: 502–508.
Cruickshank, R.; Duguid, J.P.; Marmion, B.P. and Swain, R.H.A. (1975): Medical Microbiology, 12th ed., vol. II. Churchill Livingstone, Edinburg, London and New York.
De Boer, E. and Beumer, R.R. (1999): Methodology for detection and typing of foodborne microorganisms. International Journal of Food Microbiology 50: 119–130.
Dipineto, L.; Santaniello, A.; Fontanella, M.; Lagos, K.; Fioretti, A. and Menna, L.F. (2006): Presence of Shiga toxin-producing Escherichia coli O157:H7 in living layer hens. Letters in Applied Microbiology 43 (2006) 293–295.
Elmalı, M. and Yaman, H. (2005): Microbiological quality of raw meat balls: produced and sold in the eastern of Turkey. Pakistan. J. Nutr, 4 (4), 197–201.
Estrada, C.S.; Velasquez, L.D., Genaro, S.D. and Guzman, A.M. (2007): Comparison of DNA extraction methods for pathogenic Yersinia enterocolitica detection from meat food by nested PCR. Food Res. Inter., 40: 637–642.
Ezzat, M.E.; Zaki, E.M.S.; Mohammed, G.M.O. and Rabie, M.A. (2014): Molecular characterization of pathogenic E. coli isolated from meat and their products. Suez Canal Veterinary Medicine Journal, XIX(1):103-113.
Hu, Q.; Tu, J.; Han, X.; Zhu, Y.; Ding, C. and Yu, S. (2011): Development of multiplex PCR assay for rapid detection of Riemerella anatipestifer, Escherichia coli, and Salmonella enterica simultaneously from ducks. Journal of Microbiological Methods 87: 64–69.
ISO (1999): Microbiology of food and animal feeding stuffs – Horizontal method for the enumeration of coagulase-positive staphylococci (Staphylococcus aureus and other species) - Technique using rabbit plasma fibrinogen agar medium. International Standard ISO 6888-2, International Organization for Standardization, Geneva.
ISO (2002): Microbiology of food and animal feeding stuffs-Horizontal method for detection of Salmonella spp. ISO 6579 Organisation for Standardization.
Iyer, A.; Kumosani, T.; Yaghmoor, S.; Barbour, E.; Azhar, E. and Harakeh, S. (2013): Escherichia coli and Salmonella spp. in meat in Jeddah, Saudi Arabia. Journal of Infection in Developing Countries 7(11): 812-818.
Jeníkova, G.; Pazlarova, J. and Demnerova, K. (2000): Detection of Salmonella in food samples by the combination of immunomagnetic separation and PCR assay. Inter. J. Microbiol., 3:225–229.
Kawasaki, S.; Fratamico, P.M.; Horikoshi, N.; Okada, Y.; Takeshita, K.; Sameshima, T. and Kawamoto, S. (2009): Evaluation of a multiplex PCR system for simultaneous detection of Salmonella spp., Listeria monocytogenes, and Escherichia coli O157:H7 in foods and in food subjected to freezing. Foodborne Pathogens and Disease 6(1): 81-89.
Leclerc, V.; Dufour, B.; Lombard, B.; Gauchard, F.; Garin-Bastuji, B. and Salvat, G. (2002): Pathogens in meat and milk products: surveillance and impact on human health in France. Livest Prod Sci; 76: 195–202.
Lee, S.I.; Kang, S.G.; Kang, M.L. and Yoo, H.S. (2008): Development of multiplex polymerase chain reaction assays for detecting enterotoxigenic Escherichia coli and their application to field isolates from piglets with diarrhea. J Vet Diagn Invest 20:492–496.
Mason, W.J.; Blevins, J.S.; Beenken, K.; Wibowo, N.; Ojha, N. and Smeltzer, M.S. (2001): Multiplex PCR protocol for the diagnosis of staphylococcal infection. Journal of clinical microbiology, 39(9): 3332–3338.
Mehrotra, M.; Wang, G. and Johnson, W.M. (2000): Multiplex PCR for Detection of Genes for Staphylococcus aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin Resistance. Journal of Clinical Microbiology; 38(3).
Mensah, P.; Yeboah-Manu, D.; Owusu-Darko, K.; and Ablordey, A. (2002): Street foods in Accra, Ghana: how safe are they? Bulletin of the World Health Organization, 80: 546–553.
Murugkar, H.V.; Rahman, H. and Dutta, P.K. (2003): Distribution of virulence genes in Salmonella serovars isolated from man and animals. Indian J Med Res., 117:66-70.
Olivera, S.D.; Rodenbusch, C.R.; Ce, M.C.; Rocha, S.L.S. and Canal, C.W. (2003): Evaluation of selective and non selective en-richment PCR procedures for Salmonella de-tection. Lett. Appl. Microbiol., 36: 217-221.
Quinn, p.; Markey, B.; Carter, M.; Donelly, W. and Leonard, F. (2002): Veterinary microbiology, Microbial Disease. Black Well Science: 26-36.
Raafat, H.; Sohaila, F.H.A.; Ashraf, M.A.; Moemen, A.M and Khalid, I.E. (2011): Detection and identification of Salmonella species in minced beef and chicken meats by using Multiplex PCR in Assiut city. Veterinary World, 4 (1): 5-11.
Sarah, M.M.A. (2014):Molecular characterization of Staphylococcus aureus isolated from meat, milk and their products. M.V. Sc. Thesis, (Bacteriology, Immunology and Mycology) Faculty of Veterinary Medicine. Suez Canal University.
Scallan, E.; Griffin, P.M.; Angulo, F.J.; Tauxe, R.V. and Hoekstra, R.M. (2011): Foodborne illness acquired in the United States–unspecified agents. Emerg Infect Dis.17:16–27.
Schreiber, M.P.; Chan, C.M. and Shorr, A.F. (2011): Bacteremia in Staphylococcus aureus pneumonia: outcomes and epidemiology. J. Crit Care; 26: 395–401.
Tachbele, E.; Erku, W.; Gebre-Michael, T. and Ashenafi, M. (2006): Cockroach-associated food-borne bacterial pathogens from some hospitals and restaurants in Addis Ababa, Ethiopia: Distribution and antibiograms. J Rural Trop Public Health, 5, 34–41.
Thaker, H.C.; Brahmbhatt, M.N. and Nayak, J.B. (2013): Isolation and identification of Staphylococcus aureus from milk and milk products and their drug resistance patterns in Anand, Gujarat. Vet. World, 6 (1): 10-13.
Threlfall, E.J. (2008): Salmonella. In: Heggenhougen K, Quah S, editors. International encyclopedia of public health. Amsterdam: Elsevier: 639–47.
Ukut, O.E.; Okonko, I.O.; Ikpoh, I.S.; Nkang, A.O.; Udeze, A.O.; Babalola, T.A.; Mejeha, O.K. and Fajobi, E.A. (2010): Assessment of bacteriological quality of fresh meats sold in Calabar metropolis, Nigeria. Electronic Journal of Environmental, Agricultural and Food Chemistry 9(1): 89-100.
Vázquez-Sánchez, D.; López-Cabo, M.; Saá-Ibusquiza, P. and Rodríguez-Herrera, J.J. (2012): Incidence and characterization of Staphylococcus aureusin fishery products marketed in Galicia (Northwest Spain). International Journal of Food Microbiology 157(2): 286-296.
Zhao, C.; Ge, B.; De Villena, J.; Sudler, R.; Yeh, E.; Zhao, S.; White, D.G.; Wagner, D. and Meng, J. (2001): Prevalence of Campylobacter spp., Escherichia coli, and Salmonella serovars in retail chicken, turkey, pork, and beef from the Greater Washington, D.C., area. Applied and Environmental Microbiology 67(12): 5431-5436.