SPOILAGE POTENTIAL OF PSEUDOMONAS SPP. ISOLATED FROM DOMIATI CHEESE

SPOILAGE POTENTIAL OF PSEUDOMONAS SPP. ISOLATED FROM DOMIATI CHEESE

AHMED MOUSTAFA HAMMAD

Department of Food Hygiene and Control, Faculty of Veterinary Medicine, University of Sadat City, Sadat City, Egypt.

Tel: 01007181039

Email: hammad@vet.usc.edu.eg                                                                Assiut University web-site: www.aun.edu.eg

INTRODUCTION

Pseudomonas is a genus of Gram-negative, non-spore forming, aerobic bacteria, belonging to the family Pseudomonadaceae. Pseudomonas spp. have high genetic diversity and poor nutritional needs allowing  them  to  survive in different  environments,  such  as  atmospheric dust, vegetation, water, and soil. Additionally, these characteristics allow them to survive on the utensils and equipment used in the dairy production chain, such as milking machines, pipelines, and bulk tanks (Simões et al., 2010). Pseudomonas fluorescens, Pseudomonas   aeruginosa, and Pseudomonas putida are the main Pseudomonas spp. found in the dairy chain.

Cheese making is a major industry all over the world, and it is still practiced on a small scale, which accounts for the presence of different types of cheese (Fox and McSweeney, 2004). Domiati cheese is the most popular soft cheese in Egypt and makes up about 75% of the cheese produced and consumed in the Egyptian market (Zhang et al., 2003). Many cheese makers use raw milk or add raw milk to pasteurized milk, considering this process essential for good flavor without the addition of any starter culture. However, loss of cheeses due to bacterial spoilage is a major concern in the dairy industry. Bacterial contamination and growth can result in changes in odor, appearance, texture, and flavor that reduce the quality of dairy products (Sperber and Doyle, 2009; Martin et al., 2011). Contamination of dairy products with psychrotrophic bacteria is important for the dairy industry as they are distributed at temperatures that allow the growth of these microorganisms. Psychrotrophic bacteria are spread in nature and can be isolated from water and soil (Dogan and Boor, 2003). As psychrotrophic bacteria enter manufactured dairy products through post-pasteurization contamination in the factory, these bacteria may account for only a small fraction of the initial micro flora of processed dairy products. However, bacterial spoilage occurs when temperature during refrigerated storage allow psychrotrophic bacteria to multiply and to become the dominant microflora (Dogan and Boor, 2003; Hantsis-Zacharov, and Halpern, 2007).

Pseudomonas spp. areamong the most common microorganisms involved in spoilage of milk and dairy productsduring their refrigerated storage because many strains arepsychrotolerant (Martin       et al., 2011). In addition, many of these strains also produce heat-stable extracellular lipases, proteases and lecithinases which can further contribute to spoilage of milk and dairy products. Many of these enzymes keep their activities after thermal processing steps that can kill the bacteria produced these enzymes. Degradation of milk constituents by enzymatic activities can reduce the shelf life of dairy products. For example, when casein is digested by proteases can lead to gelation of milk and bitterness. Milk fat is hydrolyzed by lipases and yield free fatty acids, which cause milk to taste rancid and bitter (Chen et al., 2003; Morales et al., 2005; Hantsis-Zacharov and Halpern, 2007; Zhang et al., 2015). Lecithinase degrades milk fat globulemembranes and there fore, increases the susceptibility of milk fat to the action of lipases. The hydrolytic products of milk proteins and fat saffectorganoleptic quality of dairy products (Dogan and Boor, 2003). Additionally, one of the most important food-altering effects is the ability of some Pseudomonas strains to produce colored pigments, which causes food discolouration such as pyoverdine, pyocyanine, fluorescein, pyomelanin and pyorubin (Andreani et al., 2014). Therefore, the aim of this study was to determine the prevalence and phenotypic characteristics of Pseudomonas spp. isolated from Domiati cheese.

MATERIALS and METHODS

Sample Collection

Samples (n=80) of Domiati cheese collected from different supermarkets, retail and dairy shops in El-Menofia province, Egypt, and were immediately placed on ice for transportation.

Counts of Pseudomonas spp.

A volume of 225ml of trisodium citrate was added to the stomacher bags, each of them contains 25 g of cheese sample, and the samples were homogenized for 3 minutes by stomacher (Wehr and Frank, 2004). Ten-foldserial dilutions were plated onto Pseudomonas agar base (Oxoid) supplemented by cetrimide-fucidin-cephaloridine (CFC). Following 24 h incubation at 25°C, three morphologically different colonies from plates were inoculated on to nutrient agar. Presumptive  identification  of Pseudomonas spp. was made based on  colony morphology, Gram staining, oxidase production, motility, gelatin hydrolysis,   pigment  production, ability to grow  at  42°C, indol production, utilization of carbohydrates (arabinose, fructose, galactose, glucose, mannitol, sucrose, trehalose, xylose, and nitrate reduction) (Garrity et al., 2005).

Counts of proteolytic Pseudomonas spp.

0.1 mL of selected dilutions were spread in duplicate onto Pseudomonas agar plates (Oxoid Ltd., Basingstoke, UK) supplemented with penicillin (100,000 IU/L, Sigma Aldrich), and skim milk (10%) as described by Scatamburlo et al. (2015). The plates were incubated for 72 h at 25°C, and then all colonies were counted based on presence or absence of a proteolytic halo which indicate proteolytic activity. Presumptive Pseudomonas spp. were identified as described above.

Screening of extracellular enzyme producing Pseudomonas spp.

To determine production of lipases and lecithinases, Pseudomonas isolates were plated on tributyrin agar (Merck) and plate count agar (Merck) containing 10% egg yolkemulsion (Oxoid), respectively. Tributyrin agar plates were incubatedat 30°C for 48 h. Presence of a zone of hydrolysis around the bacterial colonies indicated lipase activity (Meghwanshi et al., 2006). Plate count agar plates were incubated at 37°C for 72 h. Presence of colonies surrounded by opaque zones indicated lecithinase activity (Arslan et al., 2011).

Psychrotrophic/mesophilic discrimination by growth profiles

The strains were grown on nutrient agar plates at 30 °C. The bacterial cultures were transferred to nutrient broth and grown with shaking at 7 °C for 14–21 days. All the cultures that could grow at 7 °C were defined as psychrotolerant strains, and the others as mesophilic.

Molecular analysis

Total DNA was prepared by boiling method as previously described (Féria et al., 2002). Pseudomonas spp. were confirmed by checking a genus-specific region of the 16S DNA region, as previously described by Spilker et al. (2004), and using the primers PA-GS-F (GACGGGTGAGTAATGCCTA) and PA-GS-R  (CACTGGTGTTCCTTCCTATA). For identification of P. fluorescens, a region from DNA 16S specific for P.  fluorescens was investigated using the primers 16SPS EfluF (TG- CATTCAAAACTGACTG) and 16SPSER (AATCA- CACCGTGGTAACCG) (Scarpellini et al.,2004).

All strains showed protease activity were tested by PCR for presence of specific region of the  alkaline  protease  gene (apr) that is responsible  for AprX production by Pseudomonas spp. using the primers FP apr I (TAYGGBTTCAAYTCCAAYAC) and RF apr  II  (VGCGATSGAMACRTTRCC),  as  described  by Bach et al. (2001).

RESULTS

Incidence and counts of Pseudomonas spp. and proteolytic Pseudomonas spp.

Overall, 70 cheese samples (87.5%) analyzed were contaminated with Pseudomonas spp. Mean Pseudomonas spp. counts was 4.59 ± 0.35 log cfu/g (Table 1). Eighty five presumptive Pseudomonas spp. isolates were recovered, and eighty isolates were positively identified as Pseudomonas spp. Table 2 shows the diversity and incidence of isolated Pseudomonas spp. P. fluorescens showed the highest prevalence followed by P. aeruginosa, P. putida, P. syringae, and P. alcaligenes. On the other hand mean proteolytic Pseudomonas spp. counts was3.65 ± 0.14 log cfu/g (Table 1).

Screening of extracellular enzyme producing Pseudomonas spp.

Table 3 shows the patterns of enzyme production by Pseudomonas spp. Of note, 97.5%, 87.5%and 73.7% of isolated strains showed protease, lipase and lecithinase activities, respectively. Importantly, the ability to produce the three enzymes was observed among 61.2% of isolated Pseudomonas spp. Among 36 isolated P. fluorescens strains, 75% produced all the three enzymes.

Incidence of psychrotrophic Pseudomonas spp.

In this study, 72.5% (58/80) of isolated strains were able to grow at 7°C.

Molecular analysis

PCR screening of isolates using a genus-specific primers confirmed presence of Pseudomonas spp. in 80 strains. Additionally, the incidence of P.fluorescens was confirmed by PCR using species specific primers in 45% (36/80) of strains. Alkaline protease (apr) gene was detected in 33 isolates and proteolytic activity was observed in all strains carried this gene.

Table 1: Counts of Pseudomonas spp. and proteolytic Pseudomonas spp. in log cfu/g.

Table 2: Incidence and diversity of Pseudomonas spp.

Table 3: Patterns of enzyme production by Pseudomonas spp.

DISCUSSION

Our results indicated the high prevalence of Pseudomonas spp. in Domiati cheese (87.5%). Similar results have been reported. Leriche et al. (2004) isolated Pseudomonas spp. from 54.5% of raw milk cheeses and Morales et al. (2005) isolated Pseudomonas spp. from 50% of one day old raw milk cheeses. As shown in Table 2, P. fluorescens showed high prevalence among all isolated strains, 45% (36/80). The high incidence of P. fluorescens in Domiati cheese samples likely reflects the presence of this microbe in the dairy processing environment as well as its short generation time at refrigeration temperatures. These findings are consistent with previous studies indicating that P. fluorescens is the predominant spoilage bacteria in dairy products (Arslan et al., 2011; Craven and Macauley, 1992; Dogan and Boor, 2003). Importantly, cheese contamination with psychrotrophic microorganisms is a particular concern as they are distributed at temperatures allow the growth of these organisms. Psychotropic microorganisms are those able to proliferateat or below 7 °C, regardless of their optimum growth temperature. In this study, 72.5% (58/80) of isolated strains were psychrotrophic. Of note, after 2010, the interest in P. fluorescens as spoilage microorganism in cheeses increased due to the cases of “blue mozzarella” in which some European consumers observed discoloration on the surfaces of some mozzarella products (Andreani et al., 2014). High concentrations of P. fluorescens, up to 10⁶cfu per gram of cheese was detected by microbiological analyses of these cases (Bogdanova et al., 2010). The presence of Pseudomonas spp. in food is generally an indicator of post- pasteurization contamination (Ralyea et al., 1998; Hayes et al., 2002). Interestingly, preparation processes of Domiati cheese involve specific steps that may be associated with the contamination and survival of Pseudomonas spp. First, the milk is usually not tested for microbiological quality especially at small scale production. Second, the intrinsic qualities of these cheeses, including moisture, salt content, and pH, are not adjusted to inhibit the growth of Pseudomonas spp. Third, the storage temperature, if not correctlyadjusted, could contribute to growth and multiplication of Pseudomonas spp. Our results highlights the need to improve hygienic practices during preparation of Domiati cheese.

The presence of Pseudomonas spp. and their enzymes in refrigerated Domiati cheese is of great concern to dairy manufacturers and processors of this type of cheese. Although Pseudomonas spp. are easily destroyed by the heating settings applied in the dairy industry, many of their protease and lipase activities survive high temperature short time pasteurization and even ultrahigh temperature treatment conditions and remain active in the  derived products (Chen et al., 2003; Hantsis-Zacharov and Halpern 2007; Zhang et al., 2015). The proteases and lipases may cause various instability problems and spoilage, including proteolysis, bitterness and rancidity (Rajmohan et al., 2002; Datta and Deeth 2003). As presented in Table 3, Pseudomonas spp. showed 4 patterns for enzyme production. Most of isolated strains produced protease enzyme and 75% of the P. fluorescens strains produced all the three enzymes. These results are consistence with previous studies in that large number of the P. fluorescens strains have extracellular protease, lipase and lecithinaseactivity (Wiedmann et al., 2000; Dogan and Boor, 2003; Munsch-Alatossava and Alatossava, 2006). This study give evidence that Domiati cheese can be easily spoiled by Pseudomonas spp. if exposed to temperature fluctuation in the refrigerator. Alkaline protease (apr) gene was detected in 33 isolates and proteolytic activity was observed in all strains carried this gene. Of note, someapr-negative strains showed proteolytic activity, indicating that proteases other than AprX were produced. In addition to AprXwhich considered as the most important proteolytic enzyme causing spoilage of milk and dairy products (Marchand et al.,2009; Bach et al., 2001), other proteases can be produced  by Pseudomonas spp. (Scatamburlo et al., 2015). This highlights the importance of controlling contamination by this genus during cheese production.

In conclusion, the present study demonstrated the ubiquity of Pseudomonas spp. in Domiati cheese and their ability to produce proteolytic, lipolytic and lecithinase enzymes thus emphasizing the importance of these bacteria as potential spoiler in the processing of Domiati cheese. Specifically, P. fluorescens with high spoilage potential was predominant in the analyzed samples. The presence of this type of bacteria, may depend on inadequate pasteurization of milk or using of raw milk, the efficiency of cleaning and sanitizing of utensils, and the temperature and time of storage. However, the spoilage potential of Pseudomonas spp. elucidated in this study, promote further research to control these bacteria at all stages in the processing of Domiati cheese to achieve the quality of this popular Egyptian type of cheese. 

REFRENCES

Andreani, N.; Martino, M.; Fasolato, L.; Carraro, L.; Montemurro, F.; Mioni, R.; Bordin, P. and Cardazzo, B. (2014): Tracking the blue: a MLST approach to characterise the Pseudomonas fluorescens group. Food Microbiol., 39: 116-126.

Arslan, S.; Eyi, A. and Özdemir, F. (2011): Spoilage potentials and antimicrobial resistance of Pseudomonas spp. isolated from cheeses. J. Dairy Sci., 94: 5851-5856.

Bach, H.J.; Hartmann, A.; Schloter, M. and Munch, J. (2001): PCR primers and functional probes for amplification and detection of bacterial genes for extracellular peptidases in single strains and in soil. J. Microbiol. Methods, 44: 173-182.

Bogdanova, T.; Flores Rodas, E.M.; Greco, S.; Tolli, R. and Bilei, S. (2010): Indagine microbiologic as ucampionidi mozzarella in occasionedell’allerta “Mozzarellablu”. In: XII Congresso Nazionale S.I.Di.L.V, Volume Atti, pp. 117e118.

Chen, L.; Daniel, R.M. and Coolbear, T. (2003): Detection and impact of protease and lipase activities in milk and milk powders. Int. Dairy J.,13: 255-275.

Craven, H. and Macauley, B. (1992): Microorganisms in pasteurized milk after refrigerated storage 1. Identification of types. Aust. J. Dairy Technol., 47: 38.

Datta, N. and Deeth, H.C. (2003): Diagnosing the cause of proteolysis in UHT milk. LWT- Food Sci. Technol., 36: 173-182.

Dogan, B. and Boor, K.J. (2003): Genetic diversity and spoilage potentials among Pseudomonas spp. isolated from fluid milk products and dairy processing plants. Appl. Environ. Microbiol.,69: 130-138.

Féria, C.; Ferreira, E.; Correia, J.D.; Gonçalves, J. and Caniça, M. (2002): Patterns and mechanisms of resistance to β-lactams and β-lactamase inhibitors in uropathogenic Escherichia coli isolated from dogs in Portugal. J. Antimicrob. Chemother., 49:      77-85.

Fox, P.F. and McSweeney, P.L.H. (2004): Cheese: an overview, p.1–18. In P. F. Fox, P. L. H. McSweeney, T.M. Cogan, and T.P. Guinee. (ed.), Cheese: chemistry, physics and microbiology, vol. 1. Elsevier Academic Press, London.

Garrity, G.M.; Bell, J.A. and Lilburn, T. (2005): Order IX.  Pseudomonadales. Pages 323–371 in Bergey’s Manual of Systematic Bacteriology. Vol.  2. D.  J. Brenner, N. R.  Krieg, and G.  M. Garrity, ed. Springer, New York, NY.

Hantsis-Zacharov, E. and Halpern, M. (2007): Culturablepsy chrotrophic bacterial communities in raw milk and their proteolytic and lipolytic traits. Appl. Environ. Microbiol., 73: 7162-7168.

Hayes, W.; White, C. and Drake, M. (2002): Sensory aroma characteristics of milk spoilage by Pseudomonas species. J. Food Sci., 67: 448-454.

Leriche, F.; Bordessoules, A.; Fayolle, K.; Karoui, R.; Laval, K.; Leblanc, L. and Dufour, E. (2004): Alteration of raw-milk cheese by Pseudomonas spp.: monitoring the sources of contamination using fluorescence spectroscopy and metabolic profiling. J. Microbiol. Methods, 59: 33-41.

Marchand, S.; Vandriesche, G.; Coorevits, A.; Coudijzer, K.; De Jonghe, V.; Dewettinck, K.; De Vos, P.; Devreese, B.; Heyndrickx, M. and De Block, J. (2009): Heterogeneity of heat-resistant proteases from milk Pseudomonas species. Int. J. Food Microbiol.,133: 68-77.

Martin, N.; Murphy, S.; Ralyea, R.; Wiedmann, M. and Boor, K. (2011): When cheese gets the blues: Pseudomonas fluorescens as the causative agent of cheese spoilage. J. Dairy Sci. 94: 3176-3183.

Meghwanshi, G.K.; Agarwal, L.; Dutt, K. and Saxena, R.K. (2006): Characterization of 1, 3-regiospecific lipases from new Pseudomonas and Bacillus isolates. J. Mol. Catal. B: Enzymatic, 40: 127-131.

Morales, P.; Fernández-García, E. and Nuñez, M. (2005): Volatile compounds produced in cheese by Pseudomonas strains of dairy origin belonging to six different species. J. Agric. Food Chem.,53: 6835-6843.

Munsch-Alatossava, P. and Alatossava, T. (2006): Phenotypic characterization of raw milk-associated psychrotrophic bacteria. Microbiol. Res., 161: 334-346.

Rajmohan, S.; Dodd, C. and Waites, W. (2002): Enzymes from isolates of Pseudomonas fluorescens involved in food spoilage J. Appl. Microbiol., 93: 205-213.

Ralyea, R.D.; Wiedmann, M. and Boor, K.J. (1998): Bacterial tracking in a dairy production system using phenotypic and ribotyping methods. J. Food Prot.,61: 1336-1340.

Scarpellini, M.; Franzetti, L. and Galli, A. (2004): Development of PCR assay to identify Pseudomonas fluorescens and its biotype. FEMS Microbiol. Lett., 236: 257-260.

Scatamburlo, T.; Yamazi, A.; Cavicchioli, V.; Pieri, F. and Nero, L. (2015): Spoilage potential of Pseudomonas species isolated from goat milk. J. Dairy Sci., 98: 759-764.

Simões, M.; Simões, L.C. and Vieira, M.J. (2010): A review of current and emergent biofilm control strategies. LWT- Food Sci. Technol., 43: 573-583.

Sperber, W.H. and M.P. Doyle, ed. (2009): Compendium of the Microbiological Spoilage of Foods and Beverages. Springer Science +Business Media LLC, New York, NY.

Spilker, T.; Coenye, T.; Vandamme, P. and LiPuma, J.J. (2004): PCR-based assay for differentiation of Pseudomonas aeruginosa from other Pseudomonas species recovered from cystic fibrosis patients. J. Clin. Microbiol., 42: 2074-2079.

Wehr, H.M. and Frank, J.F. (2004): (Eds.), Standard Methods for the Examination of Dairy Products (17th), Am. Public Health Assoc., Washington, DC.

Wiedmann, M.; Weilmeier, D.; Dineen, S.S.; Ralyea, R. and Boor, K.J. (2000): Molecular and Phenotypic characterization of Pseudomonas spp. isolated from milk. Appl. Environ. Microbiol., 66: 2085-2095.

Zhang, S.; Li, H.; Uluko, H.; Liu, L.; Pang, X. and Lv, J. (2015): Investigation of protease production by Pseudomonats fluorescens BJ-10 and degradation on milk proteins. J. Food Process. Preserv., Article in press.

Zhang, X.; Kilmer, R.L. and Muhammad, A. (2003): A descriptive analysis of Egypt and Saudi Arabia who import United States dairy products, monograph MGTC 03-8. International Agricultural Trade and Policy Center, Institute of Food and Agricultural Sciences, University of Florida, Gainesville. Available at: http://www.fred.ifas.ufl.edu/iatpc/_includes/mgshtml. Accessed 25 March 2014.