SEQUENCING AND PHYLOGENETIC CHARACTERIZATION OF S. AUREUS THERMONUCLEASE GENE

Assiut University web-site: www.aun.edu.eg

SEQUENCING AND PHYLOGENETIC CHARACTERIZATION OF S. AUREUS THERMONUCLEASE GENE

ALSAGHER O. ALI and HASSAN Y.A.H. MAHMOUD

Division of Infectious Diseases, Animal Medicine Department, Faculty of Veterinary Medicine, South Valley University, Qena 83523, Egypt.

Received: 26 October 2015;      Accepted: 17January 2016

INTRODUCTION

Mastitis is considered the most predominant infectious disease causing economic losses in dairy industry all over the world. (Seegers et al., 2003 and Petrovski et al., 2006). The effective consequences of mastitis occur due to chronic nature of the disease, high economic losses, widely spread all over the year and dramatic decrease the milk productivity. (Sudhan and Sharma, 2010).

Bacterial species are the most common pathogenic agents causing mastitis in bovine. The reports indicates more than 137 microbes are the etiological agents of mastitis. (Watts, 1988), belongingto a wide variety of bacteria, mycoplasma, yeast and fungi. The staphylococci is considered one of the most effective species whichinducing mastitis (Giesecke et al., 1994).

Corresponding author: Alsagher O. Ali

E-mail address: alsagher.ali@vet.svu.edu.eg

Present address: Division of infectious Diseases, Animal Medicine Department, Faculty of Veterinary Medicine, South Valley university, Qena 83523, Egypt.

S. aureus causes intramammary infection through the teat orifice, breaching the streak canal, and entering the mammary gland. The adherence of the bacterium to the epithelial cells of the mammary gland make it difficult to be washed away. In addition, it secretes different factors through which decreasing the phagocytic activity like protein A, capsuleand pseudo capsule (Sutra and Poutrel, 1994).

Staphylococcus aureus infection is characterized by intermittent shedding from the infected udder and consequently the bacteriologically negative results of the examined milk may do not guarantee that the animal is free from infection (Radostitis et al., 2000).

There are a number of methods such as polymerase chain reaction (PCR) that have been used for this purpose. PCR has proven to be a powerful research tool, and its use for the sensitive and specific detection of microorganisms and antibiotic resistance genes is increasing in clinical microbiology laboratories. PCR has been used to amplify a segment of the nuc gene that is specific for S. aureus (Khan   et al., 2007 and Zahan et al., 2009).

MATERIALS and METHODS

Sampling:

A total of 248 milk samples (mastitic and apparently normal) from dairy cows belonging to 3 Egyptian governorates (Qena, Damietta and Al-Bouhaira) 80, 139 and 29 and the number of mastitic and apparently healthy cattle in the 3 groups are 18 -62, 59-80 and 0-29 respectively. All samples forming the first and second group were collected from established dairy farms while the last group were collected from solitary home raising dairy cattle.

The milk samples were collected in sterile single use disposable plastic falcon tubes with tightly fitted caps (15 ml), all the sanitary measurement used routinely in milk samples collection were adopted and all collected samples were frozen immediately at -20ºC (Pamela, 2005)

Methods:

Isolation and culturing of S. aureus:

The frozen samples were thawed at the room temperature for 4-6 hrs and thoroughly mixed with vortex till complete homogenization. The preparation of baired-parker media and pouring into sterile petri-dishes (9 cm diameter) followed according to the method (Baired-parker, 1962). 3 typical and large colonies was harvested and picked up by a sterile metal bacteriological loop and then immersed in the glycerol stock and kept immediately at -70 to -80 ºC (Feltham et al., 1978 ; Jones et al., 1991).

Biochemical tests:

The coagulase test was performed by two different methods; the slide coagulase test and tube coagulase test (Cookson, 1997 and Wichelhaus et al., 1999).

Preparation of PCR reaction of NUC gene:

DNA preparation from bacterial culture (McLauchlin et al., 2000):

Picking up one or two of pure colonies of overnight growth cultures on Blood agar and melted with 40 ul water (DNase free water) and heated for 5 minutes at 95 ºC in a thermocycler.

Oligonucleotide primers

Forward and reverse primers of NUC gene (100pmol/ul, eurofins MWG Operon),. were diluted in sterile water (Invitrogen TM, Carlsbad, CA) to make a final concentration 20pmol/ul for each primer; SA_nuc (F)5′GCGATTGATGCTGATACGGTT′3 and SA_nuc(R)5′ AGCCAAGCCTTGA CGAACTAAA ′3 (Brakstad et al., 1992).

Procedures:

PCR products of NUC gene were performed using microbial DNA, Taq polymerase (Qiagen) and Master Mix solution. PCR master mix was prepared in a PCR tubes on ice (25 µl of PCR mixture); samples were placed in a thermocycler (Gene Amp- PCR system 2700 Version 2.0- Bio systems A&B). The PCR conditions were adjusted according to NUC gene after optimization trials to reach the best melting temperature. Amplification conditions were denaturation for 3 min at 94ºC, followed by 30 cycles of 94ºC for 1 min, 58ºC for 1 min and 72ºC for 1 min, with final extension at 72ºC for 5 min. The PCR products were analysed by 2 % agarose gel electrophoresis (Seakemâ LE Agarose, Cambrex Bioscience, Rockland, Inc. Rockland, ME USA). PCR products (267 bp) were purified following the QIAquick PCR Purification kit protocol (QIAGEN) and PCR fragments were chemically labelled with fluorescent dyes to be sequenced.

Statistical and sequence analysis

Sequence alignments, translations, and comparisons were carried out using BIOEDIT (Version 7.0.9.0, Hall, T.A, 1999). The BLAST algorithm was used to search the NCBI GenBank (http://www.ncbi. nlm.hih.gov/) databases for homologous sequences.

Neighbor-joining trees (Saitou and Nei, 1987), were constructed on the basis of genetic distances, estimated by Kimura’s (1980) two-parameter method, using MEGA 5 (Kumar et al., 2001; http://www.megasoftware.net). The reliability of the trees was estimated by bootstrap confidence values (Felsenstein, 1985) and 500 bootstrap replications were used.

The NUC gene sequences used to construct the neighbour-joiningtree (Figure 3) (by NCBI Gen Bank accession numbers); the S. aureus NUC genes sequencesare CP011147, LNB31036, CP010944, CP010943, CP010940, CP010526, CP010300, CP010299, CP010298 and the S. epidermidis NUC gene sequences are HG813242 and CP000029.

RESULTS

Prevalence of Staphylococci:

The total prevalence of staphylococci from mastitic and apparently normal dairy cattle which isolated on baired –parker agar media are shown in table (1).

Coagulase test:

All staphylococci isolates were tested by slide coagulase test and tube coagulase test (table 2) to differentiate between coagulase positive and coagulase negative S. aureus.

PCR product:

PCR reaction revealed 21 positive amplicons of NUC gene and their length 267 bp in the presence of negative and positive controls which is characteristic for S. aureus

Predicted amino acid sequences:

The predicted amino acids  of the NUC gene sequences detectedin this study are shown aligned with a reference predicted amino acid sequenceof the publishedgene bank sequences CP011147, LNB31036, CP010944, CP010943, CP010940, CP010526, CP010300, CP010299, CP010298.By estimating the coefficient variance of the S. aureus NUC gene sequences by using Wu-Kabat variability coefficient (Wu and Kabat, 1970), an amino acid site with a value of variability of 1 is monomorphic, while a site with a value exceeding 2 is polymorphic. The sequences isolated in this study show complete similarities between all local sequences and those sequences obtained from the gene bank except in one amino acidposition p58 (local sequence A15) which needs more investigation with large number of samples to detect if this variation is true variation or artefact.

Phylogenetic analysis:

The tree was constructed using the nucleotide sequences of 10 NUC  genes isolated from S. aureus (local isolates, represented by boxes) and 9 sequences obtained from the genbank as mentioned before (represented by circle). The tree was rooted to 2 NUC genes of S. epidermidis sequences as out-groups (represented by triangle). All sequences were trimmed to similar length corresponding to the same region before generating the tree (figure 3). The tree showed high degree of similarities between all nuc sequences of local isolates or that imported from the gene bank.

Table 1: Staphylococci on baired-parker agar media

Table 2: Detection of Coagulase positive and negative Staphylococci

CPS: coagulase positive Staphylococci

CNS: coagulase negative Staphylococci

Table 3: S. aureusconfirmation by PCR test

Figure 1: PCR products on gel electrophoresis (nuc gene) for characterization of S. aureus. Lane ML: 100 bp DNA marker, Lane 1: positive control for S. aureusnuc gene, Lane 2: negative control for S. aureusnuc gene and Lanes 3 to12: Positive S. aureus strains

Figure 2: Alignment of the predicted amino acids of NUC gene, amino acids are presented in one letter-code. Dots represent residues identical to the AAs in the top sequence.

Figure 3: Phylogenetic analysis of Neighbour-joining tree of NUC gene sequences.

DISCUSSION

Detection of subclinical mastitis and the causative agent is the prerequisite for undertaking therapeutic measures. The PCR method has originally been used in human medicine, but currently the first attempts are reported at adopting it to diagnosis of mastitis in cattle (Phuektes et al., 2003). Compared to conventional methods of identification of S. aureusisolates, the PCR method is less laborious, cheaper and more accurate. In the future it is likely to be predominant method of identification of pathogenic bacteria. In the present study the identification of S. aureus isolates was performed conventionally and with the PCR method.

Brakstad et al. (1992) have developed a PCR assay specific for S. aureus by targeting the nuc gene coding for staphylococcal thermonuclease. This assay was shown to be suitable for diagnostic purposes and this method was used in the present study for identification S. aureus isolates which gave nuc gene; amplicon size 276-bp that was successfully amplified from the genomic DNA of S. aureus (figure 1). 21 S. aureus isolates (87.5%) gave positive results by PCR in comparison to conventional coagulase test method (table 3).

The nuc genes annotated by homology comparison to thermonuclease were almost ubiquitous in the genus Staphylococcus. Current reports showed that regardless of their thermonuclease activity, all of the staphylococci investigated except for the Staphylococcus sciuri group carried nuc genes ( Sasaki et al., 2007), which is a species closely related to the genus Staphylococcus. Additionally, there were nuc genes in thermophilic bacteria, these results suggest that the nuc genes might have been derived from thermophilic bacteria and might have been acquired by the common ancestor of staphylococci after divergence from the S. sciuri group (Kwok and Chow., 2003).

Sequence alignments and phylogenetic analysis show a great level of similarities between different nuc gene alleles isolated from different isolates of S. aureus except a minor level of variations which needs further investigations (figure 2&3).

On conclusion, S. aureus is a highly significant pathogens inducing dramatic impact on the wide array of livestock production sectors which is reflected on the public health issue. The Nuc gene is used routinely for the characterization of S. aureusand the sequence analysis and phylogenetic studies revealed high degree of similarities which indicating this gene one of the monomorphic genes.

ACKNOWLEDGEMENTS

This work was funded through small scale grant from the South Valley University Higher studies and scientific research sector.

We appreciate from all members of Animal Medicine Department, Faculty of Veterinary Medicine, South Valley University, Qena, Egypt for their support and help.

REFERENCES

Baird-Parker, A.C. (1962): J. Appl. Bacteriol., 25:12.

Brakstad, O.G.; Aasbakk, K. and Maelamd, J.A. (1992): Detection of Staphylococcus aureus by polymerase chain reaction amplification of nuc gene. Journal of Clinical Microbiology 30, 1654–1660.

Cookson, B.D. (1997): Staphylococcus aureus. In principles in clinical bacteriology, edited by M. Emmerson, C. Kibbler and P. Hawkey, John Willey Oxford 109-130.

Felsenstein, J. (1985): The American naturalist Volume 125, No. 1, pp 1-15

Feltham, et al. (1978): J. Appl. Bacteriol. 44, 313-316.

Giesecke, D.; Ehrentreich, L.; Stangassinger, M. and Ahrens, F. (1994): Mammary and renal excretion of urine metabolites in relation to energy intake and milk yield in dairy cows. J. Dairy Sci. 77: 2376-2381.

Jones et al. (1991): Maintenance of bacteria on glass beads at -60°C to -76°C. In: Kirsop and Doyle (eds.) Maintenance of microorganisms and cultures cells, 2nd edition, p. 45-50. Academic Press.

Khan, AH.; Shamsuzzaman, AKM. and Paul, SK, et al. (2007): Antimicrobial Susceptibility and Coagulase Typing of MRSA Strains at Mymensingh Medical College. Bangladesh J Med Microbiol. ;1(2):56-60.

Kimura, M. (1980): A simple method for estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16: 111-120.

Kumar, S.; Tamura, K.; Jakobsen, IB. and Nei, M. MEGA2: (2001): Molecular evolutionary genetics analysis software. Bioinformatics.  2001 Dec; 17(12): 1244-5.

Kwok, A.Y. and Chow, A.W. (2003): Phylogenetic study of Staphylococcus and Macrococcus species based on partial hsp60 gene sequences. Int. J. Syst. Evol. Microbiol. 53: 87–92.

Pamela Ruegg (2005): Evaluating the Effectiveness of Mastitis Vaccines., University of Wisconsin – Madison 2005, 3-21.

Petrovski, K.R.; Trajcev, M. and Buneski, G. (2006): Areview of the factors affecting the costs of bovinemastitis. Journal of the South African Veterinary Association 77: 52-60.

Phuektes, P.; Browning, G.F.; Anderson, G. and mansell, P.D. (2003): Multiplex polymerase chain reaction as a mastitis screening test for S. aureus, Str. agalactiae, Str. Dysgalactiae and Str. Uberis in bulk milk samples. Journal of Dairy Research 70, 149-155.

Radostitis, O.M; Gay, C.C; Blood, D.C and Hinchcliff, K.W. (2000): Veterinary Medicine: A Textbook of the diseases of cattle, sheep, pigs, goats and horses. 9th Ed. WB Saunders Company Ltd. Philadelphia, pp: 603-700.

Saitou, N. and Nei, M. (1987): The neighbor-joining method: A new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4: 406-425.

Sasaki, T.; Kikuchi, K.; Tanaka, Y.; Takahashi, N.; Kamata, S. and Hiramatsu, K. (2007): Reclassification of phenotypically identified staphylococcus intermedius strains. J. Clin. Microbiol., 45 (9) pp. 2770–2778.

Seegers, H.; Fourichon, C. and Beaudeau, F. (2003): Production effects related to mastitis and mastitis economics in dairy cattle herds. Veterinary Research, 34: 475-491.

Sudhan, N.A. and Sharma, N. (2010): Mastitis: An important production disease of dairy animals. 1st Edn., Published by Sarva Manav Vikash Samiti, Gurgoan, India, pp: 72-88.

Sutra, L. and Poutrel, B. (1994): Virulence factors involved in the pathogenesis of bovine intramammary infections due to Staphylococcus aureus. J. Med. Microbiol. 40:79-89.

Watts, J.L. (1988): Etiological agents of bovine mastitis. Vet. Microbiol; 16: 41–66.

Wichelhaus, T.A.; Kern, S.; Schäfer, V. and Brade, V. (1999): Rapid detection of epidemic strains of methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol, 37, pp. 690–693.

Wu, T.T. and Kabat, E.A.  (1970): An analysis of the sequences of the variable regions of Bence Jones proteins and myeloma light chains and their implications for antibody complementarity. J. Exp. Med. 132: 211-250.

Zahan, NA.; Hossain, MA.; Musa, AK.; Shamsuzzaman, AK.; Mahamud, MC. and Mamun, AA. et al. (2009): PCR for mecA gene of methicillin resistant Staphylococcus aureus. Mymensingh Med J.; 18(1): 21-6.