 
								Document Type : Research article
Authors
1 Food Hygiene Dept. Mansoura Provential Lab. Animal Health Research Institute
2 Food Hygiene Dept. Mansoura Provential Lab, Animal Health Research Institute
3 Microbiololgy Dept. Mansoura Provential Lab, Animal Health Research Institute
Abstract
Keywords
Assiut University web-site: www.aun.edu.eg
SENSORY AND BACTERIOLOGICAL EVALUATION OF SOLD CHILLED DUCK AND QUAIL CARCASSES IN MARKETS
EL-DOSOKY, H.F.A. 1; NASHWA, M. ZAKI 1 and RAMADAN, A.H. 2
1 Food Hygiene Dept. Mansoura Provential Lab, Animal Health Research Institute
2 Microbiololgy Dept. Mansoura Provential Lab, Animal Health Research Institute
Received: 30 September 2018; Accepted: 30 October 2018
| 
 ABSTRACT 
 Chilled poultry carcasses are usually subjected to the bacterial contamination during evisceration, preparation and handling. Some of these bacteria are harmful to consumers causing toxicity or infective agents. Hence, this study was done on some chilled duck and quail carcasses collected separately from different supermarkets at Mansoura city and sent to the laboratory for determination of the sensory characters and counts of aerobic plate count (APC), in addition to the prevalence rate of E. coli, Staph. aureus, Salmonella sp. and Listeria monocytogenes. The obtained results of counts for APC, E. coli and Staph. aureus were 4.9±3.2; 3.2±2.1 and 2.7±1.6 log10cfu/g for chilled duck carcasses and 4.7±3.6; 3.0±2.3 and 2.8±1.4 log10cfu/g for chilled quail carcasses respectively. While, the prevalence rate of E. coli, Staph. aureus, Salmonella sp. and L. monocytogenes were 20%; 22%; 6% and 18% in chilled duck carcasses and 24%; 18%; 0% and 16% for chilled quail carcasses respectively. Serologically the isolated E. coli serotypes were O6, O55, O44 and O127 in chilled duck carcasses and O6; O44 and O78 in chilled quail carcasses and the isolated strains of Salmonella were Salmonella enteritidis and Salmonella anatum in chilled duck carcasses. By PCR the examined isolates of E.coli contained stx1 and stx2 in chilled duck and quail carcasses. While, the examined Staph. aureus by PCR contained the enterotoxigenic strains A, E, C, D enterotoxins in chilled duck carcasses and A, C, D enterotoxigenic strains in chilled quail carcasses. The hygienic importance of isolated bacteria and methods of minimizing its incidence were discussed. 
 Key words: Sensory character; Bacteria; duck; quail carcasses. 
 | 
 
INTRODUCTION
Poultry meat constitutes a substantial portion of human diet. In fact, the world average annual consumption of poultry has increased steadily and now exceeds beef, Because of this high level of consumption, the microbiological quality of poultry purchased in retail markets is of concern for suppliers, consumers and public health officials worldwide so, the bacterial contamination of fresh poultry carcasses has important implications for food safety and product shelf life (FAO, 2011).
Duck and quail meat are an excellent sources of animal-derived high quality proteins. marketed through many supermarkets and its consumers have greatly increased.
Chilled duck and quail carcasses often contaminated with food spoilage and pathogenic microorganisms
Corresponding author: EL-DOSOKY, H.F.A.
E-mail address: rafat552008@yahoo.com
Present address: Food Hygiene Dept. Mansoura Provential Lab, Animal Health Research Institute
during slaughtering and processing that decreases its quality and constitutes a public health hazards. Quail meat is a sweet and delicate white game meat with extremely low skin fat and low cholesterol value. Also, it is rich in a wide range of vitamins and minerals including vitamin B6, niacin, thiamin, pantothenic acid and riboflavin, folate and vitamin E and K. It is therefore recommended for people with high cholesterol levels and those who want to maintain a low level of cholesterol, (Michael, 2014).
Darwish et al. (2015) stated that E. coli was one of the foodborne pathogens associated with several cases of human sickness. E. coli could be isolated from the examined duck meat. Despite the high value of poultry meat, there is no accurate control and inspection on poultry carcasses. Therefore, possibility for transmission of some bacteria such as E. coli, which is one of the main causes of food poisoning. Hence, carcass contamination during slaughtering and processing is a major risk for subsequent foodborne infections in human.
The most dominant pathogens involved were E. coli O157, Staph. aureus and L. monocytogenes (Chapman et al., 1997 and Abbasi et al., 2012) and Tamarapu et al. (2001) mentioned that Staph. aureus considered as one of the most important Staphylococci species and the third worldwide cause of foodborne illnesses in addition to Freitas et al. (2013) who stated that Salmonella spp. was present in the examined quail carcasses in three evaluated flocks and in the scalding water of one flock. Recently, Kanwal et al. (2015) detect the incidence of E. coli and Salmonella through conventional culture method by 82.5% and 66.6% and by multiplex PCR 90% and 82% respectively in quail meat.
Therefore the present study was designed to determine the sensory quality and the prevalence of some bacteria having hygienic importance that may found in sold chilled duck and quail carcasses.
MATERIALS AND METHODS
1- Collection of samples: One hundred random chilled duck and quail carcasses samples (50 samples each) were collected separately from different supermarkets at Mansoura city and sent to the laboratory in icebox for examination without delay then, subjected to the following:
2- Sensory examination: Experts in sensory evaluation to evaluate chilled duck and quail carcasses where changes in appearance, odor and texture were recorded and freshness quality scheme was developed according to Costell (2002) and Botta (1995) as follows six trained persons 30-60 years of age made assessments and the sum of points for each sample was transformed to a percentage of maximum demerit points and was expressed as the demerit score.
3- Determination of pH value: It was carried out according to Pearson (1984).
4- Preparation of the samples for Bacteriological examinationaccording to (APHA 2001): Upon reciept to the laboratory 25 g from each of the examined carcass (skin and muscles) were homogenized with 225 ml 0.1% peptone water in a stomacher for 3 minutes at 3000 rpm and filtered through a sterile cheese cloth filter, followed by ten fold six serial dilutions in 0.1% peptone water to determine:
A- Aerobic plate count according to APHA (2001).
B- Total count of E. coli: E. coli was detected by using sorbitol MacConkey agar medium (Oxoid, England). The isolated E. coli were analyzed biochemically and serologicallyaccording toForbes et al. (2002).
C- Isolation of Staph. aureus according to FDA (2002) using Baird-Parker agar plates, incubated at 35oC for 48 hr. and the suspected Staph. aureus colonies were picked up, and confirmed by catalase, coagulase, thermostable nuclease and Voges-Proskauer tests.
D- Isolation of Salmonella according to the technique recommended by (FDA, 2007)on enrichment Rappaport vassiliades broth at 350C for 24h, platting onto XLD agar at 420C for 24h. The presumptive colonies were confirmed biochemically and serologically.
E- Isolation of L. monocytogenesaccording to the technique recommended by USDA; FSIS (1989) and FAO (1992).
F- Detection of virulence genes: the isolated Staph. aureus and E. coli were examined by using PCR for detection of Staph. aureus enterotoxins and E. coli (stx1 and stx2).
1- DNA extraction for isolated Staph. aureus:
a- DNA extraction from samples was performed using the QIA amp DNA Mini kit (Qiagen, Germany, GmbH) with modifications from the manufacturer’s recommendations. Briefly, 200 µl of the sample suspension was incubated with 10 µl of proteinase K and 200 µl of lysis buffer at 56OC for 10 min. After incubation, 200 µl of 100% ethanol was added to the lysate. The sample was then washed and centrifuged following the manufacturer’s recommendations. Nucleic acid was eluted with 100 µl of elution buffer provided in the kit.
b- Oligonucleotide Primers used were supplied from Metabion (Germany) are listed in Table 1.
c- For multiplex PCR of enterotoxins, Primers were utilized in a 50- µl reaction containing 25 µl of Emerald Amp Max PCR Master Mix (Takara, Japan), 1 µl of each primer of 20 pmol concentration, 8 µl of water, and 7 µl of DNA template. The reaction was performed in an Applied biosystem 2720 thermal cycler.
d- Analysis of the PCR Productsthe products of PCR were separated by electrophoresis on 1.5% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature using gradients of 5V/cm. For gel analysis, 30 µl of the multiplex PCR products were loaded in each gel slot. Gelpilot 100 bp DNA ladder (Qiagen, Germany, GmbH) was used to determine the fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra) and the data was analyzed through computer software.
2- DNA extraction for isolated E. coli:
a- DNA extraction from samples was performed using the QIA amp DNA Mini kit (Qiagen, Germany, GmbH) with modifications from the manufacturer’s recommendations. Briefly, 200 µl of the sample suspension was incubated with 10 µl of proteinase K and 200 µl of lysis buffer at 56oC for 10 min. After incubation, 200 µl of 100% ethanol was added to the lysate. The sample was then washed and centrifuged following the manufacturer’s recommendations. Nucleic acid was eluted with 100 µl of elution buffer provided in the kit.
b- Oligonucleotide Primers used were supplied from Metabion (Germany) are listed in Table 1.
c- PCR amplification for stx1, stx2 duplex PCR, primers were utilized in a 50- µl reaction containing 25 µl of Emerald Amp Max PCR Master Mix (Takara, Japan), 1 µl of each primer of 20 pmol concentration, 13 µl of water, and 8 µl of DNA template. The reaction was performed in an Applied biosystem 2720 thermal cycler.
d- Analysis of the PCR Products The products of PCR were separated by electrophoresis on 1.5% agarose gel (Applichem, Germany, GmbH) in 1x TBE buffer at room temperature using gradients of 5V/cm. For gel analysis, 20 µl of the uniplex PCR products and 30 µl of the duplex PCR products were loaded in each gel slot. Generuler 100 bp DNA ladder (Fermentas, sigma) was used to determine the fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra) and the data was analyzed through computer software.
 
Table 1: Primers sequences, target genes, amplicon sizes and cycling conditions for Staph. aureus, E. coli used in multiplex PCR.
| organism | Target gene | Primers sequences | Amplified segment (bp) | Primary denaturation | Amplification (35 cycles) | Final extension | Reference | ||
| Secondary denaturation | Annealing | Extension | |||||||
| Staph. aureus | Sea | GGTTATCAATGTGCGGGTGG | 102 | 94˚C 5 min. 
 
 | 94˚C 30 sec. 
 
 | 50˚C 40 sec. 
 
 | 72˚C 40 sec. 
 
 | 72˚C 10 min. 
 | Mehrotra et al., 2000 | 
| CGGCACTTTTTTCTCTTCGG | |||||||||
| Seb | GTATGGTGGTGTAACTGAGC | 164 | |||||||
| CCAAATAGTGACGAGTTAGG | |||||||||
| Sec | AGATGAAGTAGTTGATGTGTATGG | 451 | |||||||
| CACACTTTTAGAATCAACCG | |||||||||
| Sed | CCAATAATAGGAGAAAATAAAAG | 278 | |||||||
| ATTGGTATTTTTTTTCGTTC | |||||||||
| See | AGGTTTTTTCACAGGTCATCC | 209 | |||||||
| CTTTTTTTTCTTCGGTCAATC | |||||||||
| E. coli | stx1 | ACACTGGATGATCTCAGTGG | 614 
 | 94˚C 5 min. | 94˚C 30 sec. | 58˚C 40 sec. | 72˚C 45 sec. | 72˚C 10 min | Dipineto et al., 2006 
 | 
| CTGAATCCCCCTCCATTATG | |||||||||
| stx2 | CCATGACAACGGACAGCAGTT | 779 | |||||||
| CCTGTCAACTGAG CAGCACTTTG | |||||||||
Statistical analysis:
The results are expressed as log mean ± Standard Error (SE). Data were statistically analyzed using statistical analysis systems.
RESULTS
Table 2: Sensory quality evaluation of duck (group 1) and quail (group 2) carcasses according to Costell (2002) and Botta (1995).
| parameter | characteristic | demerit points | 
| Color | Characteristic meat color opaque yellowish | 0 1 2 | 
| Odor (fresh) 
 | Normal Neutral Trace off odor | 0 1 2 | 
| Odor (boiled) | Normal Neutral Abnormal urine | 0 1 2 | 
| Flesh texture | Firm Slightly soft Soft | 0 1 2 | 
| Wetness | Normal Slightly dry or slightly wet Moderatly dry or moderatly wet | 0 1 2 | 
| Contamination (feather, feces, blood patches) | None Slight Moderate | 0 1 2 | 
| Fat appearance | White Opaque Yellowish | 0 1 2 | 
| Rancidity (odor) | Absent Slight Moderate | 0 1 2 | 
| Package | Normal Defective broken | 0 1 2 | 
| Maximum demerit points for duck and quail carcasses (group1&2) | 17 &19 | |
  Table 3: Sensory and pH evaluation of the examined duck and quail carcasses
| Groups | Demerit score (%) | pH | 
| Group (1) duck carcasses | 9.7±2.8 | 5.8 ±0.2 | 
| Group (2) quail carcasses | 15.4±2.05 | 5.9 ±0.2 | 
Demerit score % =total Demerit points transformed to a mean ± SE percentage of maximum demerit points attainable.
Table 4: Microbial mean counts of the Examined Duck and Quail Carcasses expressed as logmean±SE (n=50 for each).
| carcassestype 
 Isolated organisms | Duck carcasses | Quail carcasses | ||||
| APC | E. coli | Staph. aureus | APC | E. coli | Staph. aureus | |
| Bacterial count | 4.9±3.2 | 3.2±2.1 | 2.7±1.6 | 4.7±3.6 | 3.0±2.3 | 2.8±1.4 | 
Table 5: Prevalence of the Isolated Bacteria from Examined Duck and Quail Carcasses (n=50 for each).
| carcassestype 
 
 Isolated organisms | Duck carcasses | Quail carcasses | ||||||
| E. coli | Staph. aureus | Salmonella | L. mono cytogenes | E. coli | Staph. aureus | Salmonella | L. mono cytogenes | |
| Positive no | 10 | 11 | 3 | 9 | 12 | 9 | ND | 8 | 
| Prevalence% | 20 | 22 | 6 | 18 | 24 | 18 | - | 16 | 
NB: n=50 means number of examined carcasses from duck or quail carcasses; ND=not detected
%=according to the No of examined carcass samples.
Table 6: Serological identification of isolated E. coli and Salmonella in the examined positive duck and quail carcasses.
| Identified strains of isolated Salmonella in Duck carcasses | quail carcasses | duck carcasses | No | Serotypes of E. coli 
 | |||
| Antigenic structure | No | isolated Salmonella | |||||
| H | O | ||||||
| g,m: 1,7 | 1,9 ,12 | 2 | Salmonella enteritidis | 1 | 2 | 3 | O44 | 
| e,h: 1,6 | 3,10,15, 3,4 | 1 | Salmonella anatum | 2 | 3 | 5 | O6 | 
| 
 | 
 | 
 | 
 | - | 2 | 2 | O55 | 
| 
 | 
 | 
 | 
 | 3 | - | 3 | O78 | 
| 
 | 
 | 
 | 
 | - | 4 | 4 | O127 | 
Fig. (1): Agarose gel electrophoresis of E. coli PCR products isolated from chilled duck carcass samples using stx1 and stx2 primers.
Lane "1": 100 bp DNA ladder
Lane "2 ": positive amplification of\614 bp for stx1 gene and 779 bp for stx2.
Lane "3": positive amplification of 779 bp for stx2.
Lane "4": negative amplification for stx1 and stx2 genes.
Lane "5": positive amplification of 779 bp for stx2.
Multiplex PCR for Staph. aureus enterotoxins genes:
Total number of 5 isolates from Staph. aureus tested by using multiplex PCR by using sets of primers for enterotoxins (A,B,C,D and E). The results obtained by multiplex PCR showed that the
Fig (2): Agarose gel electrophoresis of Staph. aureus PCR products isolated from chilled duck carcass samples using Staph. aureus enterotoxins primers.
Lane "1": 100 bp DNA ladder
Lane "2 ": positive amplification 209 bp for enterotoxin E and 451 bp for enterotoxin C
Lane "3": positive amplification of 102 bp for enterotoxin A, 278 bp for enterotoxin D and 451 bp for enterotoxin C
Lane "4": positive amplification of 102 bp for enterotoxin A and 278 bp for enterotoxin D
Lane "5": negative amplification for Staph. aureus enterotoxins
Lane "6": positive amplification of 102 bp for enterotoxin A
 
DISCUSSION
Sensory examination of duck and quail carcasses
Although dressing of each meat species should be regarded as a unique process. Hence, Evaluation of freshness and potential consumer acceptance defined in terms of carcass characteristics such as appearance, color, odor and texture which were one of the principal aims of this study. Therefore, the sensory quality of duck and quail carcasses were determined on the basis of quality grading assessment Costell, (2002) to which demerit points ranging from 0 to 3 (table 2), the lower score the better quality. All the examined carcass samples for sensory quality inspected separately for each and they were within the acceptable limit.
Hydrogen ion concentration (pH):
The variation in pH could be a factor in declaring the types of microorganisms growing on poultry carcasses (Hulot and Ouhayoun, 1999). Our results recorded in (table 3) revealed that pH values of examined duck and quail carcass samples were 5.8 ±0.2 and 5.9 ±0.2 respectively. These results nearly agree with (El-Shehry, 2012) who stated that pH of chicken meat were 5.91 and (Youssef, 2013) found poultry meat pH mean value were 5.64±0.02. Higher results were recorded by Afifi, (2000) in poultry meat with value of (6.15). The decrease in pH value may be attributed to the breakdown of glycogen with the formation of lactic acid and the increase of pH may be due to the partial proteolysis. Poultry meat with a pH below 5.8 had a pale color, while meat with higher pH had dark color and has a great risk on human health. However, the ideal pH for meat is between 5.8 and 6.3 (Pearson and Gillette, 1996).
The bacterial count of any food article is not indicative about its safety for consumption, yet it was of more importance in judging the hygienic conditions under which it had been produced, handled and stored (Jay, 1997).
The recorded results in (table 4) showed that the mean APC for duck and quail carcasses were 4.9±3.2 and 4.7±3.6 log10cfu/g respectively with prevalence rate of 100% in duck and quail carcasses. These results were nearly similar to that reported by (Nyo et al., 2010) where the APC were 4.8 log10cfu/g of the examined slaughtered duck carcass samples and (Edris et al., 2011) where they found 9x104±1.43x104 cfu/g in Quail meat meanwhile, slightly higher than (Alvarez-Fernandez et al., 2009) who found that the mean aerobic count were 4.01±0.48 log10cfu/g in duck carcasses. The higher bacterial counts of examined carcasses may be due to unsatisfactory sanitation during handling, processing and distribution as well as inadequate chilling which increase the existing organisms as reported by (Thatcher and Clark, 1973). These results were in accordance with the Egyptian Organization for Standardization and Quality Control (EOS) No. 1651 (2005) for APC in chilled poultry meat (<105cfu/g).
There is no accurate control and inspection on poultry carcasses in the slaughter houses. Therefore, the possibility of some bacterial transmission such as E. coli, which is one of the main causes of foodborne pathogens associated with several cases of human sickness.
People with low immunity are the prime target of the pathogenic strains of E. coli. The main habitat of E.coli is the intestinal tract of human and animal. So its presence indicates fecal contamination. Moreover, many strains of the organism are enteropathogenic and give rise to acute diarrheal hemorrhagic enteritis in adults (Law 2000 & Akbar and Anal, 2011).
The obtained results in (tables 4&5) showed that the mean value of E. coli counts in chilled duck and quail carcasses were 3.2±2.1 and 3.0±2.3 log10cfu/g with prevalence rate 20% and 24% respectively. Serologically (table 6) the isolated E. co