MYCOPLASMA OVIPNEUMONIA: ISOLATION AND MOLECULAR IDENTIFICATION IN DISEASED SHEEP FLOCK IN DELTA REGION, EGYPT

Document Type : Research article

Authors

1 Department of Bacteriology, Mycology and immunology, Faculty of Veterinary Medicine, Mansoura University, Mansoura, Egypt 35111

2 Department of Internal Medicine, Infectious and Fish Diseases, Faculty of Veterinary Medicine, Mansoura University, Mansoura, Egypt 35111. Animal Medicine

3 Mycoplasma Department, Animal Health Research Institute, Dokii, Giza

4 Department of Bacteriology, Mycology and immunology, Faculty of Veterinary Medicine, Mansoura University, Mansoura, Egypt 35111.

5 Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine, New Valley, Assiut University, Egypt

Abstract

Mycoplasma ovipneumoniae (M. ovipneumoniae) was isolated from nasal swabs obtained from sheep with respiratory manifestations in delta region, Egypt; wherein 31 sheep with different ages were suffer from nasal discharge, cough, pneumonia, keratoconjunctivitis in a flock of sheep containing 134 sheep. By mycoplasma culture, nine samples were positive from 31examined samples (29%). M.ovipneumoniae is detected in 33.33% (3 out of 9 isolates of mycoplasma) using PCR with specific primer. The high percentage of isolation found in more than one-year age group, strains were isolated from the nasal swabs and no detection from ocular swabs. Isolated M. ovipneumoni strain subjected to sequencing and was designated as NMD-EG016, which showed a 94.6% 16S-23S RNA intergenic spacer sequence identity with three USA strains (M. ovipneumoniae-2014-2278-10, Mycoplasma.sp. clone-10OR05 and M.ovipneumoniae-1992-6751-17) and >94.4with standard strain ATCC 29419. 

Keywords


Assiut University web-site: www.aun.edu.eg

 

MYCOPLASMA OVIPNEUMONIA: ISOLATION AND MOLECULAR IDENTIFICATION IN DISEASED SHEEP FLOCK IN DELTA REGION, EGYPT

                                                                                                                                                               

NERMIN A. IBRAHIM 1; M.A. EL BESKAWY 2; DINA ELSHAFAY, Y.3;

AMANY M. ABD-ELMOATY 1 and YASSER F. ELNAKER 4

1 Department of Bacteriology, Mycology and immunology, Faculty of Veterinary Medicine,

Mansoura University, Mansoura, Egypt 35111.

2 Department of Internal Medicine, Infectious and Fish Diseases, Faculty of Veterinary Medicine,

Mansoura University, Mansoura, Egypt 35111. Animal Medicine

3 Mycoplasma Department, Animal Health Research Institute, Dokii, Giza

4 Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine,

New Valley, Assiut University, Egypt

 

Received: 3 May 2018;  Accepted: 30 July 2018

 

 

ABSTRACT

 

Mycoplasma ovipneumoniae (M. ovipneumoniae) was isolated from nasal swabs obtained from sheep with respiratory manifestations in delta region, Egypt; wherein 31 sheep with different ages were suffer from nasal discharge, cough, pneumonia, keratoconjunctivitis in a flock of sheep containing 134 sheep. By mycoplasma culture, nine samples were positive from 31examined samples (29%). M.ovipneumoniae is detected in 33.33% (3 out of 9 isolates of mycoplasma) using PCR with specific primer. The high percentage of isolation found in more than one-year age group, strains were isolated from the nasal swabs and no detection from ocular swabs. Isolated M. ovipneumoni strain subjected to sequencing and was designated as NMD-EG016, which showed a 94.6% 16S-23S RNA intergenic spacer sequence identity with three USA strains (M. ovipneumoniae-2014-2278-10, Mycoplasma.sp. clone-10OR05 and M.ovipneumoniae-1992-6751-17) and >94.4with standard strain ATCC 29419. 

 

Key words:  Mycoplasma ovipneumoni, Sheep, PCR.

 

 


INTRODUCTION

 

Mycoplasma species are recognized for many diseases as arthritis, respiratory, eye lesions, genital disease and mastitis (Sharif and Muhammad 2009), Mycoplasma Diseases leads to major economic losses in small ruminant (Nicholas, 2002). Additionally, Mycoplasma ovipneumoniae (M. ovipneumoniae), M. arginini and M. agalactiae are the most important causes of sheep respiratory diseases (Lin et al., 2008).

 

M. ovipneumoniae causes lethal pneumonia in sheep and goats as it is the infectious agent in ovine pleuropneumonia (Lin et al., 2008; Dassanayake et al., 2010). This organism is prevalent and highly contagious in almost every flock, causing major economic losses in the ovine industry worldwide. Compared to other pathogenic mycoplasmas, studies on M. ovipneumoniae are restricted by many aspects including the lack of the entire genomic sequence.

 

 
   

 


Corresponding author: Dr. YASSER F. ELNAKER

E-mail address: yasserelnaker@yahoo.com

Present address: Department of Animal Medicine (Infectious Diseases) Faculty of Veterinary Medicine, New Valley, Assiut University, Egypt

This markedly hinders the understanding of the pathogenic mechanisms and the molecular basis of M. ovipneumoniae infection. (Minion et al., 2004). 

 

Using high quality samples in sensitive molecular diagnostic techniques led to identification of M. ovipneumoniae which previously ignored bacterium as a primary causative agent of pneumonia in bighorn sheep (Besser et al., 2008, 2012a, b) more over When introduced into native bighorn sheep populations, outbreaks of polymicrobial pneumonia arise, sometimes resulting in high mortality in all age classes (Besser et al., 2014).  M. ovipneumoniae is also associated with mild and transient respiratory disease, usually in juveniles, in its normal domestic sheep and goat hosts (DaMassa et al., 1992, Martin and Aitken 2000). However, several investigators have reported that M. ovipneumoniae infections in domestic sheep and goats can cause severe pneumonia, particularly when multiple strains are present (Parham et al., 2006, Rifatbegovi, et al., 2011).

 

Mycoplasma naturally need weeks to culture and also many serological tests are non-specific and insensitive as they are highly fastidious. Recently, many mycoplasma species have been detected by using PCR. Laura McAuliffe et al. (2005). Although M. ovipneumoniae is very important in sheep and goat industry, little genomic information is available. Therefore, this study was aimed to detect and sequencing the genome of M. ovipneumoniae to help further studies in the future.

 

MATERIALS AND METHOD

 

Study area and animals

This study carried out on a sheep flock containing 134 sheep in a private farm located at Dakahalia governorate in the north of delta region. Sheep were suffering from respiratory signs associated with ocular, nasal discharge, eye cloudiness, coughing and rise of body temperature during January 2016. The flock was grazing outdoors all day and at night was kept indoors.  Sheep were allocated according to their age into, three groups 40 sheep (more than 1 year), 35 lambs (1-6) months old and 59 lambs (6 months – 1 year old), history of vaccination and epidemiological data of the flock were recorded.

 

  1. Clinical examination

Clinical examination of sheep flock was done according to Kelly (1990).

 

Samples

 

Nasal and ocular Nasal swabs:

62 swabs (31 Nasal and 31 ocular swabs) were collected from the diseased sheep, classified as 10 nasal and 10 ocular swabs from lambs (1-6) months of age, 9 ocular and 9 nasal swabs from lambs of (7 months – 1 year), and 12 ocular and 12 nasal swabs from sheep more than 1 year old. The swabs were collected on PPLO broth and then transmitted on icebox as early as possible to Mycoplasma Department, Animal Health Research Institute, Dokki, Egypt for Mycoplasma isolation and identification.

 

  1. Isolation of Mycoplasma:

Media used for cultivation and isolation of Mycoplasma:

 

  1. a.    Liquid and solid media for the isolation and propagation of Mycoplasma were prepared as described by Sabry and Ahmed (1975).

 

  1. b.    Digitonin sensitivity test was done for the obtained isolates according to Erno and Stipkovits (1973).

 

  1. c.     Biochemical characterization was carried out by glucose fermentation and arginine deamination tests as described by Erno and Stipkovits (1973). Film and spot formation medium (Fabricant and Freundt, 1967).

 

  1. Polymerase chain reaction (PCR):

 

  • Preparation of samples for DNA extraction (Yleana et al., 1995), One ml of outgrown suspension cultures was centrifuged for 10 min at 8 000rpm. The pellet was washed twice in 200 µl of phosphate buffered saline (PBS). The pellet was then suspended in 25 ml of H20, heated in a boiling water bath for10 min to break the cell membranes, rapidly chilled on ice then Centrifuged for taking supernatant.

 

  • Primer Selection.

 

 

Table 1: Primers of Mycoplasma.

 

Target agent

Target gene

Primers sequences

Amplified segment (bp)

Primary

den.

Amplification (35 cycles)

Reference

Sec. den.

Ann.

Ext.

Final ext.

M. ovipneumoniae

16S–23S intergenic spacer

GGAACACCTCCTTTCTACGG

402

94˚C

5 min.

94˚C

30 sec.

58˚C

45 sec.

72˚C

45 sec.

72˚C

10 min.

 Besser et al., 2012b

CCAAGGCATCCACCAAATAC

Den.=denaturation, sec=secondary, Ann=annealing, Ext=extension



  • PCR amplification

PCR amplification for Mycoplasma was performed in 50 μl reaction mixture consisting of 12 µl of 50 ng  Mycoplasma genomic DNA, 25 µl of 2 x Master mix (Multiplex gen) VIVANTIS ,2 µl of 50  pmol of each primer, and 9 µl of DNase- RNase- free, deionized water. DNA amplification was performed as shown in Table (2), Following amplification, 5 μl of each amplicon was mixed with sample buffer and applied on agarose gel 1% (w/v) containing 0.5 μg of ethidium bromide. The samples were electrophoresed at 50 volts for 20 min on a horizontal electrophoresis unit. A 100 bp DNA ladder was used as molecular weight standard (VIVANTIS). After electrophoresis, the gel was visualized photographed.

 

  1. Selected published sequences of 16S-23S intergenic spacer rRNA genes which were used in sequence analysis and phylogeny:

 

>  M.ovipneumoniae-ATCC 29419 gbAY753216.1 

 >M.ovipneumoniae-2014-2278-10  gbKU986496.1washintagon USA

>Mycoplasma.sp.clone-10OR05 gbJN857916.1 USA

 >M.ovipneumoniae-1992-6751-17 gbKU986493.1USA

  > M.ovipneumoniae-2006-7402a gbKU986494.1

 >M.ovipneumoniae-1987-3722-1 gbKU986492.1  

>M.ovipneumoniae-2009-11512-3 gbKJ551511.1

>M.ovipneumoniae-10-698-1 gbHQ615162.1 

>M.ovipneumoniae-2014-7753-3 gbKU986495.1

 

  1. Sequence and phylogenetic analysis

DNA Sequencing of ISR gene was conducted in both directions and a consensus sequence of 422 (gbpaper450) bp was used for nucleotide analysis. The original sequence was trimmed to remove vague nt. sequences usually exist in the beginning of the sequencing reaction. Partial DNA sequences was submitted to GeneBank database and obtained accession number; KY562849. Identification of homologies between nucleotide sequence of the studied Mycoplasma ovipneumoniae and others published in GenBank was done using BLAST 2.2 search program (National Center for Biotechnology Information “NCBI” http://www.ncbi.nlm.nih.gov/). Comparisons of the obtained nucleotide sequence with other Mycoplasma sequences that published in GenBank were done using the BioEdit sequence alignment editor (Hall, 1999) and MegAlign, Dnastar, Lasergene®, Version 7.1.0, USA. The phylogenetic trees were constructed using MegAlign for tree reconstruction of sequences by Neighbor-joining method based on ClustalW (Thompson et al., 1994). MegAlign calculated sequence divergence and identity percentages.

 

RESULTS

 

 I.     Clinical examination

Examined sheep showed, nasal and ocular discharge, ocular cloudiness and keratoconjunctivitis in addition to coughing and rise of body temperature, these signs were obvious in the age group less than 1 year old (1- 6 months of age) Table (2).  Fig (1).

 

 

 

Fig (1): Photo-showing sheep suffer from mucopurullent nasal discharge

 

Table 2: Clinical examination of sheep flock.

Main clinical signs

Clinical examination

Age group

%

Diseased

Total

 

Ocular discharge, nasal discharge, coughing and rise of body temperature

28.57

10

35

1-6 months

Ocular discharge, eye cloudiness, nasal discharge, coughing and rise of body temperature

15.25

9

59

7 - 12 months

Ocular discharge, eye cloudiness, nasal discharge, coughing

30

12

40

More than 1 year months

 

23.13

31

134

Total


  1. Isolation of Mycoplasma spp. from nasal and ocular nasal discharge.

Mycoplasma spp. was isolated from 9 out of 31 examined nasal swabs by (29%) while all examined ocular swabs were negative for isolation table(3). The highest isolation rate were recorded in more than one-year age group sheep by 41.67%

 

 

Table 3: Isolation rate of Mycoplasma spp from nasal and ocular swabs in relation to age.

 

Ocular swabs

Nasal swabs

Age group

%

Positive

Samples (No.)

%

Positive

Samples (No.)

0                              0                         10

0                              0                         10

10

20

2

10

1-6 months

0                              0                            9

0                              0                            9

9

22.22

2

9

7 months-1year

0                              0                         12

0                              0                         12

12

41.67

5

12

More than 1 year

0                              0                         31

0                              0                         31

31

29

9

31

Total

 

 

 

 

 

 

 

 

 

 

 

 

 

Fig (2).   Percent of Mycoplasama ovipneumoni isolation from nasal, ocular swabs of sheep in relation to age.

 


P.C. R Detection of M. ovipneumonea

Of the 9 cases found positive Mycoplasma spp, 3 isolates were positive with specific species primers for M. Ovipneumonea. The bands obtained were 402 bp. Fig (2). The three positive isolates of M. ovipneumoniae were recognized in 1 - 6-month age group, 2 isolates and one isolates in 7 – 12-month age group and not detected in age group over than 12 months of age.


 

Table 4: Identification of isolated Mycoplasma spp. using PCR.

 

Total isolates

Mycoplasma ovipneumoni

%

Another Mycoplasma

%

9

3

33.33

6

66.66

 

 

 

 

 

 

 

 

 

 

 

 

Fig (3): Gel electrophoresis of PCR products of M. ovipnumoniea16S-23S intergenic Spacer. 1: VC100BP Puls DNA Ladder, Lane 5, 6, 7 The amplified products prepared from positive Nasal Swabs of diseased sheep, Lane 2: negative control, Lanes 3, 4 &8-11 negative results.

 

 

As the presence of M.ovipneumoniae was confermed, the purified PCR product for one isolate exposed to sequencing and analysis. The sequence was submitted to NCBI GenBank (Accession number KY562849.). Phylogenetic tree was built based on the ISR gene sequence of one M. ovipneumoniae isolate with standard strain and others M. ovipneumoniae published in GenBank (Fig.4). The isolate showed 94.6% sequence identity with M. ovipneumoniae-2014-2278-10, Mycoplasma spp - clone-10OR05 and M. ovipneumoniae1992-6751-17 (from USA). Moreover, sequences of the isolate showed >94.4% identity with that of the standard strain (M. ovipneumoniae-ATCC).


 

Figure (4): Sequence identity and divergence between various isolates of M.ovipneumonaiea

 

 

Figure (5): Phylogenic analysis of M.ovipneumonaiae isolates based on ISR sequence.

 

 


DISCUSSION

 

Mycoplasma with their extreme antigenic variation is concerned; mycoplasmas have complex mechanisms enabling them to evade the immune system causing several clinical symptoms, leading to significant economic effect on production of small ruminants Kumar et al. (2011).

 

M. ovipneumoniae considered the greatest mycoplasmas involved in sheep respiratory diseases. Primary infection with M. ovipneumoniae may predispose sheep to the lower respiratory tract infection by another organisms, Nicholas et al. (2008). This agent is frequently isolated from pneumonic sheep.

 

In this study, clinical examination of sheep flock containing 134 sheep revealed that, 31 sheep suffered from nasal and ocular discharge, ocular cloudiness and keratoconjunctivitis in addition to coughing and rise of body temperature, the reported clinical signs agree with Kumar et al. (2012), who mentioned that pneumonia accompanied by keratoconjunctivitis, mastitis, abortions, and arthritis is commonly observed in mycoplasma syndrome.

 

These signs were obvious in the age groups less than one year old. Table (2). Fig (1), the age group more than one year, has the high rate of respiratory Manifestations, Suzanna Bell (2008) reported that, acute form of mycoplasma appear in young lambs while a chronic infection is often found in older lambs and adults also, Elnaker et al. (2017) found that high mortality rate in sheep less than one year related to M.ovipneumonaie which likewise with Beseer et al. (2008).

 

The result of mycoplasma isolation Table (3) Fig (3) revealed that 9 isolates of mycoplasma by 29% from nasal swabs while no isolation from ocular swabs which nearly similar with result of Chinedu A. Akwuobu et al. (2014) who study the prevalence of Mycoplasma species in small ruminants in Nigeria and found that 25.8% of 508 examined small ruminant nasal swab were identified by PCR/DGGE as Mycoplasma spp, also Ayşe Kılıc et al. (2013) found that 37.03 % of the isolates were mycoplasma spp by using culturing, and in our study, the high rate of isolation in age group more than one year was 41.67%.

 

Of 9 cases found positive for Mycoplasma spp, 3 isolates existed positive with species-specific primers for M. Ovipneumonea, Fig (2). The three positive isolates of M. ovipneumoniae were recognized in 1 - 6 months age group, 2 isolates and one isolates in age 7 - 12 months and not detected in age over than 12 months, this approve the suggestion of the main role of M. ovipneumonaie in sever pneumonic cases  which agree with Besser et al. (2008) who informed that M. ovipneumoniae was identified as a main member of the pneumonic lung flora in lambs with early lesions of bronchopneumonia  also Chinedu A. Akwuobu et al. (2014) reported  M. ovipneumoniae, and M. mycoides subsp. capri among the important pathogenic Mycoplasma species for small ruminant. Massimo Giangaspero et al. (2012) found 26% of the isolates were seropositive to M. ovipneumoniae, from the other hand slightly higher percent of detection was noticed by Ayşe Kılıc et al. (2013), 59.37 % of mycoplasma isolates were M. ovipneumonaie recognized by PCR, Kumar et al. (2001) noted that molecular detection of Mycoplasma species based on different set of primers was used to identify different species. Sequencing of one strain referred to presence of >94.6 identity to two USA strains and >94.4 to standard strain which give attention to further studies especially after detection of M. ovipneumonaie from deferent flocks in Egypt   producing serious pneumonic form which leads to high mortality rate.

 

Our results underscore the need to Supplementary work is necessary, both to clarify the epidemiology of mycoplasma infection in sheep, and evaluation of vaccination against Mycoplasma of mycoplasma infections in sheep.

 

CONFLICT OF INTERESTS

 

The authors declare that there is no conflict of interests in the publication of this paper.

 

REFERENCES

 

 Ayşe Kılıc; Hakan Kalender; Hatice Eroksuz; Adile Muz and Bülent Tasdemir (2013): Identification by culture, PCR, and immunohistochemistry of mycoplasmas and their molecular typing in sheep and lamb lungs with pneumonia in Eastern Turkey Trop Anim Health Prod 45: 1525–1531.  

Besser, T.E.; Cassirer E.F.; Potter K.A.; Ander Schalie, J.V.; Fischer, A.D.P.; Knowles, D.R. Herndon, Rurangirwa, F.R.; Weiser G.C. and Srikumaran, S. (2008): Association of Mycoplasma ovipneumoniae infection with population-limiting respiratory disease in free-ranging Rocky Mountain bighorn sheep (Ovis canadensis canadensis). Journal of Clinical Microbiology 46:423–430.

Besser, T.E.; Cassirer E.F.; Amada C.Y; Potter, K.A.; Herndon, C.N.; Foreyt W.J.; Knowles D.P. and Srikumaran, S. (2012a): Survival of bighorn sheep (Ovis canadensis) commingled with domestic sheep (Ovis aries) in the absence of Mycoplasma ovipneumoniae. Journal of Wildlife Disease 48:168–172.

Besser, T.E.; Highland M.; Baker K.; Cassirer E.F.; Anderson N.J.; Ramsey J. M.; Mansfield K.M.; Bruning D.; Wolff, P.; Smith, J.B. and Jenks, J.A. (2012b): Causes of pneumonia epizootics among bighorn sheep, western United States, 2008–2010. Emerging Infectious Disease 18:406– 413

 Besser, T.E.; Cassirer E.F.; Potter K.A.; Lahmers, K.; Oaks J.L.; Shanthalingam, S.; Srikumaran, S. and Foreyt, W.J. (2014): Epizootic pneumonia of bighorn sheep following experimental exposure to Mycoplasma ovipneumoniae. PLoS ONE 9(10):e110039. doi:10.1371/journal.pone.0110039.

Chinedu A. Akwuobu; Roger D. Ayling; Kennedy Foinkfu Chah and Stephen I. Oboegbulem (2014): Studies into the prevalence of Mycoplasma species in small ruminants in Benue State, North-central Nigeria. Trop Anim Health Prod (2014) 46: 1087–1092.

DaMassa, A.J.; Wakenell, P.S. and Brooks D.L. (1992): Mycoplasmas of goats and sheep. Journal of Veterinary Diagnostic Investigation 4: 101–113.

Erno, H. and Stipkovits, L. (1973): Bovine mycoplasma: Cultural and biochemicalstudies. Act. Vet. Scan.14: 450 - 463.11

Elnaker F. Yasser; Nermin A. Ibrahim and Diab S. Mohamed (2017): Microbiological and Epidemiological Studies on Sheep and Goat Deaths in New Valley Governorates, Egypt. AJVS. V. 55 (2): 28-35.

Fabricant, J.; Freundt, EA. (1967): Importance of extension and standardization of laboratory tests for the identification and classification of mycoplasma. Ann N Y Acad Sci. Jul 28;143(1): 50-58.

Hall, A. (1999): BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nuc. Acids Symp. Ser. 41, 95-98.

Kelly, W.R. (1990): Veterinary clinical diagnosis, 3rd Edition Bailliere Tidall, London.

Kumar, M.; Singh, V.P. and Srivastava N.C. (2001): Rapid and specific detection of M. Mycoides cluster and differentiation of mycoides group from capricolum group by PCR,” Indian Journal of Comparative Microbiology Immunology and Infectious Diseases, v. 22, n (2), p. 118–121,

Kumar, P.; Roy, A.; Bhanderi, B.B. and Pal, B.C. (2011): “Isolation, identification and molecular characterization of Mycoplasma isolates from goats of Gujarat State, India,” Veterinarski Arhiv, v. 81, n. 4, p. 443–458,

Kumar, A.; Verma, A.K.; Gangwar; N.K. and Rahal, A. (2012): “Isolation, characterization and anti biogram of Mycoplasma bovis in sheep Pneumonia,” Asian Journal of Animal and Veterinary Advances, v.7,( 2), p. 149–157, 2012.

Laura McAuliffe; Richard J. Ellis; Jo R. Lawes; Roger D. Ayling and Robin A.J. Nicholas (2005): 16S rDNA PCR and denaturing gradient gel electrophoresis; a single generic test for detecting and differentiating Mycoplasma species. Journal of Medical Microbiology. 54, 731–739.

Lin, YC.; Miles, RJ.; Nicholas, RA. and Kelly, DP. (2008): Isolation and immunological detection of Mycoplasma ovipneumoniae in sheep with atypical pneumonia, and lack of a role for Mycoplasma arginini. Res. Vet. Sci. 84: 367-373.

Martin, W.B. and Aitken, I.D. (2000): Mycoplasma respiratory infections. Pages 198–201 in W. B. Martin, and I. D. Aitken, editors. Diseases of sheep. Blackwell Science, Oxford, United Kingdom.

Massimo Giangaspero; Robin A.J. Nicholas; Miroslav Hlusek; Barbara Bonfini; Takeshi Osawa; Riccardo Orusa; Shingo Tatami; Eishu Takagi; Hiroaki Moriya; Norimoto Okura; Kazuo Kato; Atsushi Kimura; Ryô Harasawa and Roger D. Ayling (2012): Seroepidemiological survey of sheep flocks from Northern Japan for Mycoplasma ovipneumoniae and Mycoplasma agalactiae. Trop Anim Health Prod .44: 395–398

Minion, F.C.; Lefkowitz, E.J.; Madsen, M.L.; Cleary, B.J. (2004): The genome sequence of Mycoplasma hyopneumoniae strain 232, the agent of swine mycoplasmosis. J. Bacteriol. 186: 7123-7133.

Nicholas, R.A.J. (2002): Improvements in the diagnosis and control of diseases of small ruminants caused by mycoplasmas. Small. Rumin. Res., 45, 145–149.

Nicholas, R.; Ayling, R. and McAuliffe, L. (2008): Respiratory diseases of small ruminants. In: Nicholas, R., Ayling, R. and Mcauliffe, L., Eds. Mycoplasma Diseases of Ruminants. CABI, Wallingford, UK: 171–179.

Parham, K.; Churchward, C.P.; McAuliffe, L.; Nicholas, R.A.J. and Ayling, R.D. (2006): A high level of strain variation within the Mycoplasma ovipneumoniae populationof the UK has implications for disease diagnosis and management. Veterinary Microbiology 118: 83–90.

Rifatbegovi, C.M.Z.; Maksimovi, C. and Hulaj, B. (2011): Mycoplasma ovipneumoniae associated with severe respiratory disease in goats. Veterinary Record 168: 565.

Sabry, M.Z. and Ahmed, A.A. (1975): Evaluation of culture procedure for primaryisolation of Mycoplasmas from female genitalia of farm animals. J. Egypt. Vet. Med. Ass., 35: 18-34.9

Sharif, A. and Muhammed, G. (2009): Mastitis control in dairy animals. Pakistan Vet. J. 29, 145- 148.

Suzanna Bell (2008): Respiratory disease in sheep 1. Differential diagnosis and epidemiology In Practice (2008) 30: 200-207.

Thompson, D.; Higgins, G. and Gibson, J. (1994): CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nuc. Acids Res. 22, 4673-4680.

Yleana, R.C.J.; Bascunana, C.R.; Bolski, K.G.; Mattsson, J.G.; Molina, C.F. and Johansson, K.E. (1995): In vitro amplification of the 16S rRNA genes from M. bovis and M. agalactiae. Vet. Microbiol., 47: 183 - 190.

 

 

 

الميکوبلازما اوفينيموني :عزل وتصنيف جزيئي في قطيع من الأغنام المريضة في منطقة الدلتا ، مصر

 

نيرمين عوض ، محمد البسکاوي ، اماني عبد المعطي ، دينا الشافعي ، ياسر الناقر

 

E-mail: yasserelnaker@yahoo.com     Assiut University web-site: www.aun.edu.eg

 

تم عزل الميکوبلازما اوفينيموني من مسحات الأنف التي تم الحصول عليها من اغنام ظهر عليها اعراض تنفسيه في منطقة الدلتا ، مصر ، حيث کان 31 من الاغنام من أعمار مختلفة يعانون من إفرازات أنفية. کحه .التهاب رئوي والتهاب في العين في قطيع يحتوي على 134راس من  الأغنام. تم عزل الميکوبلازما بنسبه 29% (9من 31 عينه) باستخدام الطرق التقليديه لعزل الميکوبلازما. تم تحديد وجود33.33% من عزلات الميکوبلازما کميکوبلازما اوفينيموني (3من اصل 9) باستخدام اختبار سلسة البلمره التفاعليه.کانت اعلي نسبة عزل للميکوبلازما اوفينومني في سن اقل من 6 شهور وکلها من المسحات الانفيه.تم عمل التسلسل الجيني لواحد من عزلات الميکوبلازما اوفينيموني وتم تعريفه باسم NMD-EG016 ورقم تسجيلي KY562849 والتي اوضحت نسبة تطابق تصل الي 94.6% مع ثلاث عزلات من الولايات المتحده الامريکيه (M.ovipneumoniae-2014-2278-10, Mycoplasma.sp.clone-10OR05 and M.ovipneumoniae-1992-6751-17) باستخدام نفس التسلسل الجيني 16S-23S RNA intergenic spacer  وکذلک حوالي 94.4% مع سلالة قياسية. ATCC 29419.         

 

REFERENCES
 
 Ayşe Kılıc; Hakan Kalender; Hatice Eroksuz; Adile Muz and Bülent Tasdemir (2013): Identification by culture, PCR, and immunohistochemistry of mycoplasmas and their molecular typing in sheep and lamb lungs with pneumonia in Eastern Turkey Trop Anim Health Prod 45: 1525–1531.  
Besser, T.E.; Cassirer E.F.; Potter K.A.; Ander Schalie, J.V.; Fischer, A.D.P.; Knowles, D.R. Herndon, Rurangirwa, F.R.; Weiser G.C. and Srikumaran, S. (2008): Association of Mycoplasma ovipneumoniae infection with population-limiting respiratory disease in free-ranging Rocky Mountain bighorn sheep (Ovis canadensis canadensis). Journal of Clinical Microbiology 46:423–430.
Besser, T.E.; Cassirer E.F.; Amada C.Y; Potter, K.A.; Herndon, C.N.; Foreyt W.J.; Knowles D.P. and Srikumaran, S. (2012a): Survival of bighorn sheep (Ovis canadensis) commingled with domestic sheep (Ovis aries) in the absence of Mycoplasma ovipneumoniae. Journal of Wildlife Disease 48:168–172.
Besser, T.E.; Highland M.; Baker K.; Cassirer E.F.; Anderson N.J.; Ramsey J. M.; Mansfield K.M.; Bruning D.; Wolff, P.; Smith,