ENTEROTOXIGENIC STAPHYLOCOCCUS AUREUS IN RAW AND PASTEURIZED MILK AND SOME MILK PRODUCTS

Document Type : Research article

Authors

Food Hygiene Dept. Mansoura Provential Lab., Animal Health Research Institute, Egypt

Abstract

This study was carried out on 250 samples of milk and milk products (50 samples each of raw milk, pasteurized milk, soft white cheese, butter and ice cream). The samples were collected from different shops at Mansoura city, El Dakahlia Province, Egypt and bacteriologically analyzed to detect the prevalence of Staph. aureus and its enterotoxins using PCR and SET-RPLA kits. The results revealed that the incidence of Staph. aureus were 36, 4, 24, 8 and 4% with mean counts of 3.8±1.4, 1.78± 0.48, 3.4±1.25, 2.39±0.95 and 2.14±0.78 log10cfu/g or ml respectively. The examined positive Staph. aureus by PCR and SET-RPLA kits showed presence of the following enterotoxigenic genes in the examined raw market milk; white soft cheese and table butter samples (sea, seb and see); (sea, sed and see) and (sea and seb) respectively. Meanwhile, the enterotoxigenic genes could not be detected in the examined pasteurized milk and small scale ice cream samples thus, it is necessary to adopt a regime of good, safe and healthy production of such products with periodical cleaning and disinfection to ensure safe products for consumer.

Keywords


Assiut University web-site: www.aun.edu.eg

 

 ENTEROTOXIGENIC STAPHYLOCOCCUS AUREUS IN RAW AND PASTEURIZED MILK AND SOME MILK PRODUCTS

                                                                                                                                                  

SANYA, T. EL-GHAMRY and EL-DOSOKY H.F.A

Food Hygiene Dept. Mansoura Provential Lab., Animal Health Research Institute, Egypt

 

Received: 31 March 2018;     Accepted: 29 April 2018

 

 

ABSTRACT

 

This study was carried out on 250 samples of milk and milk products (50 samples each of raw milk, pasteurized milk, soft white cheese, butter and ice cream). The samples were collected from different shops at Mansoura city, El Dakahlia Province, Egypt and bacteriologically analyzed to detect the prevalence of Staph. aureus and its enterotoxins using PCR and SET-RPLA kits. The results revealed that the incidence of Staph. aureus were 36, 4, 24, 8 and 4% with mean counts of 3.8±1.4, 1.78± 0.48, 3.4±1.25, 2.39±0.95 and 2.14±0.78 log10cfu/g or ml respectively. The examined positive Staph. aureus by PCR and SET-RPLA kits showed presence of the following enterotoxigenic genes in the examined raw market milk; white soft cheese and table butter samples (sea, seb and see); (sea, sed and see) and (sea and seb) respectively. Meanwhile, the enterotoxigenic genes could not be detected in the examined pasteurized milk and small scale ice cream samples thus, it is necessary to adopt a regime of good, safe and healthy production of such products with periodical cleaning and disinfection to ensure safe products for consumer.

 

Key words:Enterotoxiginic, Stath. aureus, milk, milk products.

 

 


INTRODUCTION

 

Milk and Milk products are highly nutritious products specially for young and old aged due to its contents of proteins, fats, sugars, minerals and vitamins hence, they may exposed to be contaminated with bacteria through animals or its contact environment or handling and distribution. Staph. aureus was one of the dominant bacteria associated with raw milk. This might be due to the fact that milk is a good nutritive medium for microorganisms growth especially in poor sanitary conditions and lack of cooling facilities. Sattar et al. (2001) and Mubarack et al. (2010) added that Staph. aureus introduced into the milk also by droplet infection or from udder surface and milker’s hands.

 

Normanno et al. (2005); Bhatia and Zahoor (2007) and Rabello et al. (2007) mentioned that Staph. aureus commonly causes gastroenteritis resulting from consumption of contaminated food in which enterotoxigenic   staphylococci    have     grown    and

 

 

 


Corresponding author: Dr. EL-DOSOKY H.F.A

E-mail address: rafat552008@yahoo.com

Present address: Food Hygiene Dept. Mansoura Provential Lab, Animal Health Research Institute, Egypt

 

produced toxins. As these toxins are excreted from the organism, they are referred to as exotoxins. Staphylococcal enterotoxins are considered a potential biological threat because of their stability at 100°C for 1 hour.

 

Zhang et al. (1998); Atanassova et al. (2001); Loir et al. (2003) and Alegro et al. (2007) assured that Staphylococcal enterotoxicosis has a very rapid onset and course characterized by vomiting, headache, abdominal pain, and diarrhea develop as early as one to six hours after consumption of contaminated food. The symptoms resolve spontaneously within 24–48 hours. Meanwhile, Lina et al. (2004) added that Staph. aureus enterotoxicosis are due  to the classical enterotoxins (SEA, SEB, SEC, SED, SEE) and  several new variants of SEs.

 

Bergdoll (1983) and Letertre et al. (2003) concluded that the first five (A to E) classical enterotoxins are known to cause 95% of the food poisoning globally and Argudin et al. (2010) isolate 22 types of SEs designated with letters A-V are currently known. While, Bennett, (2005) demonstrated that there is a strong association between the ability of Staph. aureus strains to produce one or more of the SEs and the occurrence of staphylococcal food poisoning. Weronika and Jacek (2014) found that 11.9% of the isolated strains were positive for one or more classical SE markers. The aim of this study was to detect enterotoxigenic Staph. aureus prevalence which is a potential source of food poisoning

 

MATERIALS AND METHODS

 

Two hundred and fifty samples of milk and milk products (50 samples each) of raw market milk, pasteurized milk, soft white cheese, table butter and small scale ice cream were collected from different shops at Mansoura city and sent to the laboratory in icebox for examination without delay.

 

Enumeration and Isolation of Coagulase positive Staph. aureus according to (APHA 2001) 10 ml or g each of examined milk and milk product samples were taken aseptically and homogenized with 90 ml 0.1% peptone water in a stomacher for 3 minutes at 3000 rpm and filtered through a sterile cheese cloth filter, followed by six fold serial dilutions in 0.1% peptone water then 0.1 ml were taken from each dilution aseptically and inoculated onto Baird-Parker medium, the plates were incubated for 24-48 hours at 37°C. The plates containing 20-200 colonies were selected. Typical colonies of Staph. aureus were circular, smooth, convex, moist 2-3mm in diameter, grey to black (potassium tellurite reaction) with white margin and surrounded by outer clear zone (egg yolk reaction) the suspected colonies were streaked onto agar slant of nutrient agar medium and incubated at 37°C for 24 hours for further purification and identification by microscopical and biochemical examination by catalase, coagulase, thermostable nuclease and Voges-Proskauer tests.

 

Staph. aureus culture supernatant were collected  by Sac cultural method (Donnelly et al., 1967) and tested serologically by reversed passive latex agglutination technique using Oxoid SET-RPLA kits for the presence of SEA, SEB, SEC, SED and SEE.

 

Extraction of Staph. aureus enterotoxins from the examined samples were completed by blending of 10 ml of milk or milk product samples with 10 ml of sodium chloride solution (0.85%) and centrifuged. The supernatant was retained for toxin detection using Oxoid SET-RPLA kits Shingaki et al. (1981).

 

Detection of virulence genes in Staph. aureus using PCR (Reference Lab for Quality Control on Poultry Production, Animal Health Research Institute, Dokki -Egypt)

 

1-DNA extraction:

DNA extraction from samples was performed using the QIAamp DNA Mini kit (Qiagen, Germany, GmbH) with modifications from the manufacturer’s recommendations. Briefly, 200 µl of the sample suspension was incubated with 10 µl of proteinase K and 200 µl of lysis buffer at 56OC for 10 min. After incubation, 200 µl of 100% ethanol was added to the lysate. The sample was then washed and centrifuged following the manufacturer’s recommendations. Nucleic acid was eluted with 100 µl of elution buffer provided in the kit.

 

2- Oligonucleotide Primer. Primers used were supplied from Metabion (Germany) are listed in Table (1).

 

3- For multiplex PCR of enterotoxins, Primers were utilized in a 50-µl reaction containing 25 µl of Emerald Amp Max PCR Master Mix (Takara, Japan), 1 µl of each primer of 20 pmol concentration, 8 µl of water, and 7 µl of DNA template. The reaction was performed in an Applied biosystem 2720 thermal cycler.

 

4- Analysis of the PCR Products.

The products of PCR were separated by electrophoresis on 1.5% agarose gel (Applichem, Germany, GmbH) in 1xTBE buffer at room temperature using gradients of 5V/cm. For gel analysis, 30 µl of the multiplex PCR products were loaded in each gel slot. Gelpilot 100 bp DNA ladder (Qiagen, Germany, GmbH) was used to determine the fragment sizes. The gel was photographed by a gel documentation system (Alpha Innotech, Biometra) and the data was analyzed through computer software.


 


 


Table 1: Primers sequences, target genes, amplicon sizes and cycling conditions of Staphylococcus aureus enterotoxins.

 

Target

gene

Primers sequences

Amplified segment (bp)

Primary

denaturation

Amplification (35 cycles)

Final extension

Reference

Secondary denaturation

Annealing

Extension

 Sea

GGTTATCAATGTGCGGGTGG

102

94˚C

5 min.

 

 

94˚C

30 sec.

 

 

50˚C

40 sec.

 

 

72˚C

40 sec.

 

 

72˚C

10 min.

 

Mehrotra

et al. 2000

CGGCACTTTTTTCTCTTCGG

Seb

GTATGGTGGTGTAACTGAGC

164

CCAAATAGTGACGAGTTAGG

 Sec

AGATGAAGTAGTTGATGTGTATGG

451

CACACTTTTAGAATCAACCG

Sed

CCAATAATAGGAGAAAATAAAAG

278

ATTGGTATTTTTTTTCGTTC

See

AGGTTTTTTCACAGGTCATCC

209

CTTTTTTTTCTTCGGTCAATC

 

Statistical analysis:

The results are expressed as log mean ± standard error (SE). Data were statistically analyzed using statistical analysis systems.

 

RESULTS

 

Table 2: Mean counts of Staph. aureus in the examined samples expressed as log10cfu/g or ml (n=50).

 

Ice cream

Butter

White soft cheese

Pasteurized milk

Raw milk

Examined products

 

Microbial count

2.14±0.78

2.39±0.95

3.4±1.25

1.78±0.48

3.8± 1.4

 

Mean counts of Staph. aureus

NB: n= number of the examined samples

 

Table 3: Incidence and Disribution of enterotoxins produced by Staph. aureus strains isolated from the examined samples by SET-RPLA kits and PCR (n=50).

 

Types of produced

enterotoxins

No of strains

Producing enterotoxins

No and incidence % of the isolated  strains

Examined products

E

D

C

B

A

Frequency %

No

%

No/50

 

SEE

 

 

SEB

SEA

16.66

3

36

18

Raw market milk

-

-

-

-

-

-

-

4

2

Pasteurized milk

SEE

SED

-

-

SEA

25

3

24

12

white soft cheese

-

-

-

SEB

SEA

50

2

8

4

Butter

-

-

-

-

-

-

-

4

2

Ice cream

 


Results of Polymerase chain reaction:

Multiplex PCR for enterotoxiginic Staph. aureus genes:

Results of the isolated Staph. aureus from the examined raw milk by using multiplex PCR using sets of primers for enterotoxins (A,B,C,D and E) showed that

 

 

 

 

Fig (1): Agarose gel electrophoresis of Staph. aureus PCR products using enterotoxins Staph. aureus primer

Pos=positive control, Neg=negative control, L=100 bp DNA ladder

 

Lane "1": positive amplification of 102 bp for enterotoxin A

Lane "2 "and Lane "4" were negative 

Lane "3": positive amplification of 164 bp for enterotoxin B

Lane "5": positive amplification of 102 bp for enterotoxin A, 209 bp for enterotoxin E

 

Results of the isolated Staph. aureus from examined white soft cheese samples (Lane 1,2&3) and butter samples (Lane 4&5) by using multiplex PCR using sets of primers producing enterotoxins (A,B,C,D and E) showed that

 

 

 

Fig (2): Agarose gel electrophoresis of Staph. aureus PCR products using enterotoxins Staph. aureus primer

Pos=positive control, Neg=negative control, L=100 bp DNA ladder

 

Lane "1": positive amplification of 102 bp for enterotoxin A and 278 bp for enterotoxin D

Lane "2" positive amplification of 102 bp for enterotoxin A and 209 bp for enterotoxin E

Lane "3" positive amplification of 278 bp for enterotoxin D

Lane "4": positive amplification of 164 bp for enterotoxin B

Lane "5": positive amplification of 102 bp for enterotoxin A and164 bp for enterotoxin B

 


DISCUSSION

 

Presence of lactic acid bacteria lowering the pH in raw milk that may prevent Staph. aureus growth and enterotoxin production (Alomar et al., 2008 and  Janstova et al., 2012). Pinchuk et al. (2010) mentioned that bacterial counts of Staph. aureus need to reach 105-108 cfu/mL before sufficient amount of toxin to cause illness is produced while, Evenson et al. (1988) showed that growth of enterotoxigenic Staph. aureus up to 106 or more/g of food enables them to produce a sufficient amount of enterotoxins to cause intoxication. As little as 20ng of SE can induce nausea, violent vomiting, abdominal cramps, and diarrhea between 1 to 8 h after food consumption. The achieved results in Tables 2,3 and Fig. 1 declared that the highest contamination of Staph. aureus were found in raw market milk with mean counts of 3.8 ±1.4 log10cfu/ml with incidence percent of 36% mean while, 3 out of the examined 18 isolates by PCR and SET-RPLA kits were enterotoxigenic. The enterotoxigenic strains have sea, seb and see virulent genes, these results were nearly in accordance with Manfreda et al. (2005) who found 34.6% of milk samples were contaminated with Staph. aureus, 6.6% of which were enterotoxin producers. Enterotoxigenic strains were most frequently detected in milk with Staph. aureus count 4.47 log10cfu/ml; Bianchi et al. (2013) declared that 53% of raw milk were positive for one or more SE genes and Staph. aureus count were 3.5 ±2.38 log10cfu/ml with incidence percent of 32%. Also, Thabet et al. (2014) revealed that Staph. aureus was isolated with a percentage of 26.6% from raw milk; Hu Shou Kui et al. (2013) found  Staph. aureus in 30.0% of examined raw milk and 43.7% of the isolated Staph. aureus produced enterotoxins. These results were lower than that reported by Weronika and Jacek (2014) and Gundogan and Avc (2014) who found the incidence percent in raw milk were 56% and higher than Rajeev and Amit (2010) who could isolate Staphylococcus from milk by 10%.

 

The obtained results of Staph. aureus count and its incidence in Pasteurized milk in Tables 2 and 3 declared that the mean counts were 1.78±0.48 log10cfu/ml with incidence percent of 4% mean while, the enterotoxigenic strains of Staph. aureus could not be detected by PCR and SET-RPLA kits. These results were in accordance with those obtained by Gad EL-Said et al. (2013) who reported that no enterotoxigenic Staph. aureus were detected in pasteurized milk and Asao et al. (2003) who  added that pasteurizing raw milk would eliminate Staph. aureus from raw milk, however once the pathogens have produced enterotoxins the toxins will remain stable even after pasteurization. Also, Jicinska and Havlova (1995) concluded that because of its heat resistance, Staph. aureus can be detected even in pasteurized milk in addition to Anderson et al. (1996) shown that Staph. aureus enterotoxins are highly resistant to heat treatment, a good example is sea, which retained its biological activity even after exposure to 121°C for 28 minutes.

 

Jablonski and Bohach (2001) reported that 103 and 105cfu/g Staph. aureus is able to produce enterotoxin in amounts that can pose a health risk to the consumers.

 

The achieved results of white soft cheese in Tables 2,3 and Fig 2 declared that the mean counts of Staph. aureus were 3.4±1.25 log10cfu/g with incidence percent 24% mean while, 3 out of the examined 12 isolates were enterotoxigenic detected in examined samples by PCR and SET-RPLA kits have the enterotoxigenic virulent genes sea, sed and see. These results were lower than Gundogan and Avc (2014) who found that 48% of white cheese were contaminated with Staph. aureus. While, Thabet et al. (2014) revealed that Staph. aureus was isolated with a percentage of 6.6% in Damietta cheese samples and  Hu Shoukui et al. (2013) the positive rate of Staph. aureus in milk products including cheese were 7.5% and 43.7% of the isolated Staph. aureus produced enterotoxins. Gucukoglu et al. (2012) investigated that the enterotoxigenic Staph. aureus was detected in white cheese by 19%, two isolates from cheese samples 50% were found to be enterotoxigenic. Rahimi (2013) reported that 11.1% of examined cheese were found to be contaminated with Staph. aureus and the ability to synthesize classical staphylococcal enterotoxins (SEA-E) was determined in 7 of 20 (35%) isolates.

 

Bianchi et al. (2013) found that milk and dairy products account for 5% of all the incriminated foods poisoning.

 

Theresults of Staph. aureus incidence in Tables 2, 3 and Fig 2 of the examined table butter samples were 8% with mean count of 2.39±0.95log10cfu/g and the enterotoxigenic virulent genes of Staph. aureus was detected in 2out of 4 isolates from the examined table butter samples. The isolated enterotoxigenic strains of Staph. aureus by PCR and SET-RPLA kits have sea and sebvirulent genes. These results were nearly in accordance with Rahimi, (2013) who found 5.3% of butter samples contaminated with Staph. aureus and 35% of the isolated Staph. aureus were able to synthesize the classical staphylococcal enterotoxins (SEA-E). While, Gucukoglu et al. (2012) investigated that the enterotoxigenic Staph. aureus was detected in 30% of the examined butter samples and 25% of them showed enterotoxigenic character (SEB 100%).

 

The results in Tables 2 and 3 indicated that the incidence percent of Staph. aureus in ice cream samples were 4%, with mean counts 2.14±0.78 log10cfu/ml. The enterotoxigenic strains could not be detected in the examined samples either by PCR or by SET-RPLA kits. Bostan and Akn (2002); Sagdc et al. (2003) and Hu ShouKui et al. (2013) could not found Staph. aureus in ice creams samples while, higher percentage were reported by Gunsen (2002) who found Staph. aureus in 5% of lemon ice cream samples; Rahimi, (2013) found 5.9% ice-cream contaminated with Staph. aureus and Gundogan and Avc (2014) found Staph. aureus in 36% of the examined ice cream samples. Nazem et al. (2010) isolate Staph. aureus from 5% of ice cream collected from supermarkets; lower percentage were reported by Rajeev and Amit (2010) who isolated Staphylococcus from Ice cream by 1%; Yucel and Ctak (2002) found Staph. aureus count 1.0x102-3.0x103cfu/ml in ice cream samples. Guner et al. (2004) added that counts of Staph. aureus in ice cream were 1.2-1.7x103cfu/g and El-Ansary (2015) found Staph. aureus count was 1.10x103± 2.45x102cfu/ml in Vanilla ice cream samples, which could be associated with potential food poisoning hazards. On the other side, Gucukoglu et al. (2012) investigated that the enterotoxigenic Staph. aureus was detected in 10% of ice cream samples.

 

Asao et al. (2003) mentioned that Staph. aureus were frequently contaminator for ice cream. Hence, improvement of the hygienic practice in processing, preparing and storage should be stressed and Schmitt et al. (1990) declared that the causes of staphylococcal enterotoxicosis are classical SEs. SEA, SEB, SEC1, SEC2, SEC3, SED, and SEE and the production of SEs is unlikely at temperatures below 100C.

 

Bergdoll (1989) concluded that a very small amount of Staph. aureus enterotoxins ranging from 20 ng to < 1 μg is needed to cause a typical symptoms of staphylococcal food poisoning. An outbreak in Japan caused by low-fat milk contaminated with SEA showed that the total intake of SEA per individual was estimated to be 20–100 ng, More recently, Ostyn et al. (2010) in France found an outbreak caused by contaminated cheese, doses of SEE ingested by symptomatic persons were estimated to be about 90 ng, based on the mean weight of the cheese portion (about 200 g) and the total amount of SEE in food samples were 0.45ng/g.

 

CONCLUSION

 

The presence of enterotoxigenic Staph. aureus in raw milk and milk products poses a potential health hazard to the consumers. However, not only identification of such strains but also appropriate conditions for Staph. aureus enterotoxin genes during production and storage of milk and milk products should be taken into account in hazard risk analysis.

 

REFERENCES

 

Alomar, J.; Loubiere, P.; Delbes, C.; Nouaille, S. and Motel, M.C. (2008): Effect of Lactobacillus lactis and Enterococcus faecalis on the behaviour of Staph. aureus in microfiltered milk. Food Microbiol., 25: 502–508.

APHA (American Public Health Association) (2001): Compendium methods for the                                                                                                                                                                                                                    microbiological examination of food, Wahington, DC.

Alegro, A.L.C.; Konta, E.M. and Suzuki, K. (2007): Occurrence of coagulase positive Staphylococcus in various food products commercialized in Botucatu, SP, Brazil and detection of toxins from food and isolated strains. Food Control 18: 630-634.

Anderson, J.E.; Beelman, R.R. and Doores, S. (1996): Persistence of serological and biological activities of staphylococcal enterotoxin A in canned mushrooms. J. Food Protection 59: 1292-1299.

Argudin, M.A.; Mendoza, M.C.; Rodicio, M.R. (2010): Food Poisoning and Staph. aureus Enterotoxins. Toxins, 2: 1751–1773.

Asao T.; Kumeda, Y. and Kawai, T. (2003): An extensive outbreak of staphylococcal food poisoning due to low-fat milk in Japan estimation of enterotoxin A in the incriminated milk and powdered skim milk. Epidemiol Infect. 130: 33-40.

Atanassova, V.; Meindl, A. and Ring, C. (2001): Prevalence of Staph. aureus and staphylococcal enterotoxins in raw pork and uncooked smoked ham – a comparison of classical culturing detection and RFLP-PCR. Int. J. Food Microbiol, 68, 1–2: 105–113.

Bennett, R.W. (2005): Staphylococcal enterotoxin and its rapid identification in foods by enzyme-linked immunosorbent assay-based methodology. J. Food Prot. 68: 1264-1270.

Bergdoll, M.S. (1989): Staph. aureus In Doyle MP. editor. Food-Borne Bacterial Pathogens. New York: Marcel Dekker. 464-523.

Bergdoll, M.S. (1983): Enterotoxins. In Easton CSF, Adlam C editors. Staphylococci and staphylococcal infections. London Academic Press. 559-598.

Bhatia, A. and Zahoor, S. (2007): Staph. aureus enterotoxins. J. Clin. Diag. Res., 1: 188-197.

Bianchi, D.M.; Gallina, S.; Bellio, A.; Chiesa, F.; Civera, T. and Decastelli, L. (2013): Enterotoxin gene profiles of Staph. aureus isolated from milk and dairy products in Italy. Letters in Applied Microbiology.58, 190-196.

Bostan, K. and Akn, B. (2002): A study on the microbiological quality of industrial ice-cream. Turk Veterinerlikve Hayvanclk Dergisi. 26(3): 623-629.

Donnelly, C.B.; Leslie, J.E.; Black, L.A. and Lewis, K.H. (1967): Serological identification of enterotoxigenic Staph. aureus from cheese. Applied Microbiology. 15(6); 917-924.

El-Ansary, M.A. (2015): Hygienic quality of Vanilla ice cream sold at local market. Alexandria J. of Veterinary Sciences. 44:54-58.

Evenson, M.; Hinds, M.; Bernstein, R. and Bergdoll, M. (1988): Estimation of human dose of staphylococcal enterotoxin-A from a large outbreak of staphylococcal food poisoning involving chocolate milk. Int. J. Food Microbiol. 7, 311–316.

Gad EL-Said, W.A.; Morgan, S.D. Mona; El-Shabrawy, Azza; Abuelnaga, S.M.; Elgabry, E.A. and Mansour, S.M. Asmaa (2013): Advanced Detection of Staph. aureus Enterotoxins in Milk. Glbal Veterinaria 11 (4): 403-405.

Gucukoglu, A.; Kevenk, T.O.; Uyanik, T.; Cadirci, O.; Terzi, G. and Alisarli, M. (2012):  Detection of enterotoxigenic Staph. aureus in raw milk and dairy products by multiplex PCR. J. of Food Science. 77(11): M620-M623.

Gundogan, N. and Avc, E. (2014): Occurrence and antibiotic resistance of E. coli, Staph. aureus and Bacillus cereus in raw milk and dairy products in Turkey. International J. of Dairy Technology. 67(4): 562-569.

Guner, A.; Ardc, M. and Keles, A. (2004):  Microbiological quality of ice creams sold at pastry shops in Konya. Veteriner Bilimleri Dergisi. 20(2): 59-64.

Gunsen, U. (2002): The hygienic qualities of ice creams consumed in the centre of Bursa. Pendik Veteriner Mikrobiyoloji Dergisi. 32(1/2): 31-36.

Hu Shou Kui; Liu Shi Yun; Hu Wan Fu; Zheng Tian Li and Xu Jian Guo (2013): Molecular biological characteristics of Staph. aureus isolated from food. European Food Research and Technology. 236(2): 285-291.

Jablonski, L.M. and Bohach, G. (2001): Staph. aureus In: DOYLE M. P., BEUCHAT, L. R., MONTVILLE, T. J. (ed): Food microbiology: Fundamentals and Frontiers. Washington: ASM Press, 411-434.

Janstova, B.J.R.; Necidova, L.; Janstova, B. and Vorlova, L. (2012): Staph. aureus growth and enterotoxin production in different types of milk.  Actauniv. agric. etsilvic. Mendel. Brun., LX, No. 5; 103–108.

Jicinska, E. and Havlova, J. (1995): Patogennímikroorganismy v mléce a mléčnýchvýrobcích. 1. vyd Praha: ÚZPI, 106 s. ISBN 80-85120-47-X.

Letertre C.; Perelle S.; Dilasser, F. and Fach, P. (2003): Identification of a new putative enterotoxin SEU encoded by the egc cluster of Staph. aureus. J. Appl Microbiol 95: 38-43.

Lina, G.; Bohach, G.A.; Nair, S.P.; Hiramatsu, K.; Jouvin–Marche, E. and Maurizza, R. (2004): Standard nomenclature for the superantigens expressed by Staphylococcus. J. Infect Dis.  189, 2334-2336.

Loir, Y.; Baron, F. and Gautier, M. (2003): Staph. aureus and food poisoning. Genet Mol Res., 2, 1: 63–76.

Manfreda, G.; Mioni, R. and Cesare, A.De. (2005): Surveillance and characterization of enterotoxigenic staphylococci in foods of animal origin collected in the Veneto Region. Veterinary Research Communications; 29(Supp. 2): 331-333.

Mehrotra, M.; Wang, G. and Johnson, M.W. (2000): Multiplex PCR for detection of genes for Staph. aureus enterotoxin, exfoliative toxins, toxic shock syndrome toxin 1, and Methicillin resistance. J. of Clinical Microbiology, Vol. 38: 1032-1035.

Mubarack, H.M.A.; Doss, R.; Dhanabalan and Balachander, S. (2010): Microbial quality of raw milk samples collected from different villages of Coimbatore District Tamilnadu South India. Indian J. of Science and Technology, 3 (1): 61-63.

Nazem, A.M.; Amer, A.A. and Soukayna, A.E. (2010): Prevalence of some food poisoning microorganisms in some dairy products. Alexandria J. of Veterinary Sciences. 30(1):  1-6.

Normanno, G.; Firinu, A.; Virgilio, Mula, G.; Dambrosio, A.; Poggiu, O.; Decastelli, L.; Mioni, R.; Scuota, S.; Bolzoni, G.; Giannatale, E.; Salinetti, A.P.; Salandra, G.; Bartoli, M.; Zuccon, F.; Pirino, T.; Sias, S.; Parisi, A.; Quaglia, N.C. and Celano, G.V. (2005): Coagulase-positive staphylococci and Staph. aureus in food products marketed in Italy. Int, J. Food Microbiol, 98, 1;73-79.

Ostyn, A.; De Buyser, M.L.; Guillier, F.; Groult, J.; Felix, B; Salah, S.; Delmas, G. and Hennekinne, J.A. (2010): First evidence of a food poisoning outbreak due to staphylococcal enterotoxin type E, France, 2009. Euro Surveill 15.

Pinchuk, I.V.; Besvick, E.J. and Reyes, V.E. (2010): Staphylococcal enterotoxins.Toxins.2, 2;   177–219.

Rabello, R.F.; Moreira, B.M.; Lopes, R.M.M.; Teixeira, L.M.; Riley, L.W. and Castro, A.C.D (2007): Multilocus sequence typing of Staph. aureus recovered from cows with mastitis in Brazilian dairy herds. J. Med. Microbiol., 56, 11: 1505-1511.

Rahimi, E. (2013): Enterotoxigenicity of Staph. aureus isolated from traditional and commercial dairy products marketed in Iran.  Brazilian J. of Microbiology. 44(2):393-399.

Rajeev, K. and Amit, P. (2010): Detection of E. coli and Staphylococcus in milk and milk products in and around Pantnagar. Veterinary World. 3(11): 495-496.

Sagdc, O.; Tuluoglu, D.D.; Ozcelik, S. and Simsek, B. (2003): The chemical and microbiological quality of ice cream consumed in Isparta marked. Ziraat Fakultesi Dergisi, Ataturk Universitesi. 33(4): 441-446.

Sattar, S.A.; Springthorpe, S.; Mani, Sgallant, M.; Nair, R.C.; Scott, E. and Kain, J. (2001): Transfer of bacteria from fabrics to hand and other fabrics: development and application of a quantitative method using Staph. aureus as a model. J. Appl Microbiol., 90, 6: 962–970.

Schmitt, M.; Schuler-Schmid, U. and Schmidt- Lorenz, W. (1990): Temperature limits of growth, TNase and enterotoxin production of Staph. aureus strains isolated from foods. Int. J. Food Microbiol., 11, 1: 1–19.

Shingaki, M.H.; Igarashi, H.; Fujikawa, H.; Ushiod, T.; Terayama and Sakai, S.  (1981): Study on reversed passive latex agglutination for detection of staphylococcal enterotoxins A, B and C. Ann Rep. Tokyo Metrop.  Res. Lab. Public Health. 32(1): 128-131.

Thabet, S.S.; Amin, M.M.; Elsherif, W.M.A.; Hasan, A.M.; Wahba, N.M. (2014): Phenotypic and genotypic methicillin resistant Staph. aureus (MRSA) isolated from raw milk and somedairy products. Global J. of Agriculture and Food Safety Sciences. 1:317-325.

Weronika Korpysa-Dzirb and Jacek Osek (2014): Detection of classical genes and enterotoxins of Staph. aureus isolated from raw milk in the south-east region of Poland. Bull Vet Inst Pulawy 58, 559-561.

Yucel, N. and Ctak, S. (2002): A study on existence of some microorganisms in ice-cream samples. Turk Hijyenve Deneysel Biyoloji Dergisi. 57(3): 165-169.

Zhang, S.P.; Iandolo, J.J. and Stewart, G.C. (1998): The enterotoxin D plasmid of Staph. aureus encodes a second enterotoxin determinant (sej). FEMS Microbiol Lett, 68, 2: 227-233.

 

 


 

الميکروب العنقودى الذهبى المفرز للسموم فى اللبن الخام والمبستر وبعض منتجات الالبان

 

سنية طه الغمرى ، حاتم فتحى احمد الدسوقى

E-mail: rafat552008@yahoo.com     Assiut University web-site: www.aun.edu.eg

 

تعد الالبان ومنتجاتها من الأغذية الضرورية للإنسان فى جميع بلدان العالم لما تحتويه من عناصر غذائيه ضروريه لبناء الجسم ولکنها تعتبر من أکثر المصادر المسببه للتسمم الغذائى إذا ما تم معاملتها بطرق خاطئه من الناحية الصحية أثناء إنتاجها وتصنيعها لذا أجريت هذه الدراسة بغرض معرفة مدى تواجد ميکروب المکور العنقودى الذهبى فى اللبن الخام وبعض منتجاته فى مدينة االمنصورة - محافظة الدقهليه حيث تم جمع عدد 250 عينه بواقع 50عينة من کل من اللبن الخام واللبن المبستر والجبن الابيض الطرى والزبد والايس کريم. حيث تم تحديد المحتوى البکتيري لتواجد ميکروب المکور العنقودى الذهبى وکذا معرفة مدى تواجد السموم المعوية المفرزة منه حيث کانت نسب العزل لميکروب المکور العنقودى الذهبى کالتالي 36, 4, 24,8, 4% على الترتيب. وباعداد 3,8±1,4, 1,78±0,48, 3,4±1,25, 2,39±0,95و2,14±0,78لوج10/جم اومللى على الترتيب کما تبين وجود بعض العترات التى تنتج السموم المعوية باعداد 3, 3و2 عينات لکل من عينات اللبن الخام والجبن الابيض الطرى والزبد المختبرة على الترتيب بنسبة 16,66و25و50% على الترتيب بينما العينات المختبرة من اللبن المبستر والايس کريم  کانت سلبية للسموم المعوية للميکروب الموجب لتجلط البلازما والتي تقوم بإثارة مراکز القئ في المخ وتشکل أحد الأسباب الرئيسية للتسمم الغذائي، والذي يحدث عادة بعد تناول الأطعمة الملوثة، لاسيما منتجات الالبان الملوثة بالميکروب عن طريق سوء التعامل والتخزين في درجات حرارة مرتفعة لذلک تم فحص جينات الضرواه لکل منها واجراء اختبار تفاعل البلمرة المتسلسل لتحديد وجود جينات الضراوة sea, seb, sed and see والتي تؤثر على قدرة الميکروب فى احداث حالات مرضية عند تناول الالبان الملوثة بهذا الميکروبحيث ثبت تواجدها فى بعض الميکروبات المعزولة من العينات. وقد نوقشت الأهمية الصحية للمعزولات وکذلک کيفية الإقلال من تواجدها باتباع نظم سلامة الغذاء أثناء الاعداد والتداول.

                                                                                                                                     

 

 

 

 

 

 

 

 

 

 

 

 

REFERENCES
 
Alomar, J.; Loubiere, P.; Delbes, C.; Nouaille, S. and Motel, M.C. (2008): Effect of Lactobacillus lactis and Enterococcus faecalis on the behaviour of Staph. aureus in microfiltered milk. Food Microbiol., 25: 502–508.
APHA (American Public Health Association) (2001): Compendium methods for the                                                                                                                                                                                                                    microbiological examination of food, Wahington, DC.
Alegro, A.L.C.; Konta, E.M. and Suzuki, K. (2007): Occurrence of coagulase positive Staphylococcus in various food products commercialized in Botucatu, SP, Brazil and detection of toxins from food and isolated strains. Food Control 18: 630-634.
Anderson, J.E.; Beelman, R.R. and Doores, S. (1996): Persistence of serological and biological activities of staphylococcal enterotoxin A in canned mushrooms. J. Food Protection 59: 1292-1299.
Argudin, M.A.; Mendoza, M.C.; Rodicio, M.R. (2010): Food Poisoning and Staph. aureus Enterotoxins. Toxins, 2: 1751–1773.
Asao T.; Kumeda, Y. and Kawai, T. (2003): An extensive outbreak of staphylococcal food poisoning due to low-fat milk in Japan estimation of enterotoxin A in the incriminated milk and powdered skim milk. Epidemiol Infect. 130: 33-40.
Atanassova, V.; Meindl, A. and Ring, C. (2001): Prevalence of Staph. aureus and staphylococcal enterotoxins in raw pork and uncooked smoked ham – a comparison of classical culturing detection and RFLP-PCR. Int. J. Food Microbiol, 68, 1–2: 105–113.
Bennett, R.W. (2005): Staphylococcal enterotoxin and its rapid identification in foods by enzyme-linked immunosorbent assay-based methodology. J. Food Prot. 68: 1264-1270.
Bergdoll, M.S. (1989): Staph. aureus In Doyle MP. editor. Food-Borne Bacterial Pathogens. New York: Marcel Dekker. 464-523.
Bergdoll, M.S. (1983): Enterotoxins. In Easton CSF, Adlam C editors. Staphylococci and staphylococcal infections. London Academic Press. 559-598.
Bhatia, A. and Zahoor, S. (2007): Staph. aureus enterotoxins. J. Clin. Diag. Res., 1: 188-197.
Bianchi, D.M.; Gallina, S.; Bellio, A.; Chiesa, F.; Civera, T. and Decastelli, L. (2013): Enterotoxin gene profiles of Staph. aureus isolated from milk and dairy products in Italy. Letters in Applied Microbiology.58, 190-196.
Bostan, K. and Akn, B. (2002): A study on the microbiological quality of industrial ice-cream. Turk Veterinerlikve Hayvanclk Dergisi. 26(3): 623-629.
Donnelly, C.B.; Leslie, J.E.; Black, L.A. and Lewis, K.H. (1967): Serological identification of enterotoxigenic Staph. aureus from cheese. Applied Microbiology. 15(6); 917-924.
El-Ansary, M.A. (2015): Hygienic quality of Vanilla ice cream sold at local market. Alexandria J. of Veterinary Sciences. 44:54-58.
Evenson, M.; Hinds, M.; Bernstein, R. and Bergdoll, M. (1988): Estimation of human dose of staphylococcal enterotoxin-A from a large outbreak of staphylococcal food poisoning involving chocolate milk. Int. J. Food Microbiol. 7, 311–316.
Gad EL-Said, W.A.; Morgan, S.D. Mona; El-Shabrawy, Azza; Abuelnaga, S.M.; Elgabry, E.A. and Mansour, S.M. Asmaa (2013): Advanced Detection of Staph. aureus Enterotoxins in Milk. Glbal Veterinaria 11 (4): 403-405.
Gucukoglu, A.; Kevenk, T.O.; Uyanik, T.; Cadirci, O.; Terzi, G. and Alisarli, M. (2012):  Detection of enterotoxigenic Staph. aureus in raw milk and dairy products by multiplex PCR. J. of Food Science. 77(11): M620-M623.
Gundogan, N. and Avc, E. (2014): Occurrence and antibiotic resistance of E. coli, Staph. aureus and Bacillus cereus in raw milk and dairy products in Turkey. International J. of Dairy Technology. 67(4): 562-569.
Guner, A.; Ardc, M. and Keles, A. (2004):  Microbiological quality of ice creams sold at pastry shops in Konya. Veteriner Bilimleri Dergisi. 20(2): 59-64.
Gunsen, U. (2002): The hygienic qualities of ice creams consumed in the centre of Bursa. Pendik Veteriner Mikrobiyoloji Dergisi. 32(1/2): 31-36.
Hu Shou Kui; Liu Shi Yun; Hu Wan Fu; Zheng Tian Li and Xu Jian Guo (2013): Molecular biological characteristics of Staph. aureus isolated from food. European Food Research and Technology. 236(2): 285-291.
Jablonski, L.M. and Bohach, G. (2001): Staph. aureus In: DOYLE M. P., BEUCHAT, L. R., MONTVILLE, T. J. (ed): Food microbiology: Fundamentals and Frontiers. Washington: ASM Press, 411-434.
Janstova, B.J.R.; Necidova, L.; Janstova, B. and Vorlova, L. (2012): Staph. aureus growth and enterotoxin production in different types of milk.  Actauniv. agric. etsilvic. Mendel. Brun., LX, No. 5; 103–108.
Jicinska, E. and Havlova, J. (1995): Patogennímikroorganismy v mléce a mléčnýchvýrobcích. 1. vyd Praha: ÚZPI, 106 s. ISBN 80-85120-47-X.
Letertre C.; Perelle S.; Dilasser, F. and Fach, P. (2003): Identification of a new putative enterotoxin SEU encoded by the egc cluster of Staph. aureus. J. Appl Microbiol 95: 38-43.
Lina, G.; Bohach, G.A.; Nair, S.P.; Hiramatsu, K.; Jouvin–Marche, E. and Maurizza, R. (2004): Standard nomenclature for the superantigens expressed by Staphylococcus. J. Infect Dis.  189, 2334-2336.
Loir, Y.; Baron, F. and Gautier, M. (2003): Staph. aureus and food poisoning. Genet Mol Res., 2, 1: 63–76.
Manfreda, G.; Mioni, R. and Cesare, A.De. (2005): Surveillance and characterization of enterotoxigenic staphylococci in foods of animal origin collected in the Veneto Region. Veterinary Research Communications; 29(Supp. 2): 331-333.
Mehrotra, M.; Wang, G. and Johnson, M.W. (2000): Multiplex PCR for detection of genes for Staph. aureus enterotoxin, exfoliative toxins, toxic shock syndrome toxin 1, and Methicillin resistance. J. of Clinical Microbiology, Vol. 38: 1032-1035.
Mubarack, H.M.A.; Doss, R.; Dhanabalan and Balachander, S. (2010): Microbial quality of raw milk samples collected from different villages of Coimbatore District Tamilnadu South India. Indian J. of Science and Technology, 3 (1): 61-63.
Nazem, A.M.; Amer, A.A. and Soukayna, A.E. (2010): Prevalence of some food poisoning microorganisms in some dairy products. Alexandria J. of Veterinary Sciences. 30(1):  1-6.
Normanno, G.; Firinu, A.; Virgilio, Mula, G.; Dambrosio, A.; Poggiu, O.; Decastelli, L.; Mioni, R.; Scuota, S.; Bolzoni, G.; Giannatale, E.; Salinetti, A.P.; Salandra, G.; Bartoli, M.; Zuccon, F.; Pirino, T.; Sias, S.; Parisi, A.; Quaglia, N.C. and Celano, G.V. (2005): Coagulase-positive staphylococci and Staph. aureus in food products marketed in Italy. Int, J. Food Microbiol, 98, 1;73-79.
Ostyn, A.; De Buyser, M.L.; Guillier, F.; Groult, J.; Felix, B; Salah, S.; Delmas, G. and Hennekinne, J.A. (2010): First evidence of a food poisoning outbreak due to staphylococcal enterotoxin type E, France, 2009. Euro Surveill 15.
Pinchuk, I.V.; Besvick, E.J. and Reyes, V.E. (2010): Staphylococcal enterotoxins.Toxins.2, 2;   177–219.
Rabello, R.F.; Moreira, B.M.; Lopes, R.M.M.; Teixeira, L.M.; Riley, L.W. and Castro, A.C.D (2007): Multilocus sequence typing of Staph. aureus recovered from cows with mastitis in Brazilian dairy herds. J. Med. Microbiol., 56, 11: 1505-1511.
Rahimi, E. (2013): Enterotoxigenicity of Staph. aureus isolated from traditional and commercial dairy products marketed in Iran.  Brazilian J. of Microbiology. 44(2):393-399.
Rajeev, K. and Amit, P. (2010): Detection of E. coli and Staphylococcus in milk and milk products in and around Pantnagar. Veterinary World. 3(11): 495-496.
Sagdc, O.; Tuluoglu, D.D.; Ozcelik, S. and Simsek, B. (2003): The chemical and microbiological quality of ice cream consumed in Isparta marked. Ziraat Fakultesi Dergisi, Ataturk Universitesi. 33(4): 441-446.
Sattar, S.A.; Springthorpe, S.; Mani, Sgallant, M.; Nair, R.C.; Scott, E. and Kain, J. (2001): Transfer of bacteria from fabrics to hand and other fabrics: development and application of a quantitative method using Staph. aureus as a model. J. Appl Microbiol., 90, 6: 962–970.
Schmitt, M.; Schuler-Schmid, U. and Schmidt- Lorenz, W. (1990): Temperature limits of growth, TNase and enterotoxin production of Staph. aureus strains isolated from foods. Int. J. Food Microbiol., 11, 1: 1–19.
Shingaki, M.H.; Igarashi, H.; Fujikawa, H.; Ushiod, T.; Terayama and Sakai, S.  (1981): Study on reversed passive latex agglutination for detection of staphylococcal enterotoxins A, B and C. Ann Rep. Tokyo Metrop.  Res. Lab. Public Health. 32(1): 128-131.
Thabet, S.S.; Amin, M.M.; Elsherif, W.M.A.; Hasan, A.M.; Wahba, N.M. (2014): Phenotypic and genotypic methicillin resistant Staph. aureus (MRSA) isolated from raw milk and somedairy products. Global J. of Agriculture and Food Safety Sciences. 1:317-325.
Weronika Korpysa-Dzirb and Jacek Osek (2014): Detection of classical genes and enterotoxins of Staph. aureus isolated from raw milk in the south-east region of Poland. Bull Vet Inst Pulawy 58, 559-561.
Yucel, N. and Ctak, S. (2002): A study on existence of some microorganisms in ice-cream samples. Turk Hijyenve Deneysel Biyoloji Dergisi. 57(3): 165-169.
Zhang, S.P.; Iandolo, J.J. and Stewart, G.C. (1998): The enterotoxin D plasmid of Staph. aureus encodes a second enterotoxin determinant (sej). FEMS Microbiol Lett, 68, 2: 227-233.