MOLECULAR CHARACTERIZATION OF CLOSTRIDIUM PERFRINGENS ISOLATED FROM TURKEYS

Document Type : Research article

Authors

1 Poultry Diseases Dept., Animal Health Research Institute, Mansoura

2 1 Department of Poultry Diseases, Animal Health Research Institute, Mansoura Branch, Egypt.

3 2 Department of Microbiology, Animal Health Research Institute, Mansoura Branch, Egypt.

Abstract

A total of 82 C. perfringensisolates (41%) were recovered from 200 samples collected from 100 turkeys (20 apparently healthy, 40 clinically diseased and 40 freshly dead), 4-6 weeks old. The clinical signs of diseased birds were sudden mortality, depression, ruffled feathers, diarrhea, dehydration, emaciation and decrease in feed consumption with increase in water consumption. While, postmortem findings were consistent with necrotic enteritis (NE), the small intestine was severely affected. Small and demarcated lesions were found in the duodenal loop, hepatitis and cholecystitis were also observed. Unopened intestines were gas-filled and enlarged with thin wall. The intestinal contents were dark due to necrotic material. The opened intestines showed necrotic lesions of varying severity of the mucosa. Isolation and biochemical identification of C.perfringenswere done.Five C.Perfringens field isolates were analyzed by PCR assay to determine the presence of some toxin genes.In all tested isolates, the Cpa gene (alpha toxin) was detected (100%) confirming the isolates were C.perfringens. While, Cpb (beta toxin) gene was detected in two samples (40%). But the Etx gene (epsilon toxin) was not detected in any isolate (0%). NetB gene was detected in two isolates (40%). Antimicrobial susceptibility of 40 C.perfringens field isolates recovered from turkeys revealed that C.perfringens isolates were sensitive to Ampicillin (85%), Amoxicillin (85%), Penicillin (82.5%), Florfenicol (72.5%), Enrofloxacin (67.5%), Vancomycin (65%), Bacitracin (60%), Oxytetracyclin (32.5%), Lincomycin (22.5%) and Clindamycin  (15%).These five C. perfringens isolates were also screened by PCR which detected the presence of tetracycline resistance gene tet(K) in three isolates (60%)  and Lincomycin resistance gene lin(B) in three isolates (60%).    

Keywords

Main Subjects


Assiut University web-site: www.aun.edu.eg

 

MOLECULAR CHARACTERIZATION OF CLOSTRIDIUM PERFRINGENS ISOLATED FROM TURKEYS

       

ELGAOS, M.I. 1; KHALIL, M.R. 1; MAHMOUD, A. ABDELRAHMAN 2 AND AHMED, H. RAMADAN 2

1 Department of Poultry Diseases, Animal Health Research Institute, Mansoura Branch, Egypt.

2 Department of Microbiology, Animal Health Research Institute, Mansoura Branch, Egypt.

 

Received: 31 December 2019;     Accepted: 31 January 2020

 

 

ABSTRACT

 

A total of 82 C. perfringensisolates (41%) were recovered from 200 samples collected from 100 turkeys (20 apparently healthy, 40 clinically diseased and 40 freshly dead), 4-6 weeks old. The clinical signs of diseased birds were sudden mortality, depression, ruffled feathers, diarrhea, dehydration, emaciation and decrease in feed consumption with increase in water consumption. While, postmortem findings were consistent with necrotic enteritis (NE), the small intestine was severely affected. Small and demarcated lesions were found in the duodenal loop, hepatitis and cholecystitis were also observed. Unopened intestines were gas-filled and enlarged with thin wall. The intestinal contents were dark due to necrotic material. The opened intestines showed necrotic lesions of varying severity of the mucosa. Isolation and biochemical identification of C.perfringenswere done.Five C.Perfringens field isolates were analyzed by PCR assay to determine the presence of some toxin genes.In all tested isolates, the Cpa gene (alpha toxin) was detected (100%) confirming the isolates were C.perfringens. While, Cpb (beta toxin) gene was detected in two samples (40%). But the Etx gene (epsilon toxin) was not detected in any isolate (0%). NetB gene was detected in two isolates (40%). Antimicrobial susceptibility of 40 C.perfringens field isolates recovered from turkeys revealed that C.perfringens isolates were sensitive to Ampicillin (85%), Amoxicillin (85%), Penicillin (82.5%), Florfenicol (72.5%), Enrofloxacin (67.5%), Vancomycin (65%), Bacitracin (60%), Oxytetracyclin (32.5%), Lincomycin (22.5%) and Clindamycin  (15%).These five C. perfringens isolates were also screened by PCR which detected the presence of tetracycline resistance gene tet(K) in three isolates (60%)  and Lincomycin resistance gene lin(B) in three isolates (60%).    

 

Key words: C. perfringens, multiplex PCR, toxin and resistance genes.

 

 


INTRODUCTION

 

Clostridium perfringens is an important bacterial pathogen, especially in poultry, where it can lead to both subclinical and clinical disease. Necrotic enteritis is caused by toxins produced by C. perfringens, which is often found in the intestinal tract of healthy birds, and when it grows in the intestinal tract, it can produce toxins. The disease may occur in the form of outbreaks in poultry and especially in broiler and turkeys flocks, causing acute clinical disease characterized by necrotic enteritis (Engstrom et al., 2003).

 

Clostridium perfringens is a Gram-positive, spore-forming and anaerobic bacterium responsible for a wide range of diseases in humans and animals (Manteca et al., 2002). The pathogenicity of C. perfringens is closely related to the production of major lethal toxins (alpha, beta, epsilon, and iota

 

 


Corresponding author: Dr. ELGAOS, M.I.

E-mail address: elgaos122@gmail.com       

Present address: Department of Poultry Diseases, Animal Health Research Institute, Mansoura Branch, Egypt

toxins) and other toxins, including enterotoxin (Hatheway, C. L., 1990). Clostridium perfringens is commonly classified to toxigenotypes based on the types of toxins they produce. The main toxins produced by strains of C. perfringens are alpha, beta, epsilon, and iota toxins(Songer and Meer, 1996).Necrotic enteritis is caused predominantly by C. perfringens type A, and to a lesser extent by type C (Cooper and Songer, 2009). Alpha-toxin has long been believed to be the critical virulence factor in NE (Al-Sheikhly and Truscott, 1977), but Cooper et al. (2010) showed that alpha toxin may not be an essential causative factor of NE. More recently, a novel toxin, NE toxin B (NetB), has been discovered and strongly associated with the pathogenesis of NE (Keyburn et al., 2010). Some authors consider NetB the most important bacterial virulence factor for development of NE, although both NetB-positive and NetB-negative strains have been found associated with NE (Timbermont et al., 2011).

 

The conventional method of C.perfringens typing is based on the detection and typing of the toxins with toxin neutralization test in mice. This procedure consumes a lot of antisera and experimental animals. Moreover, it is time consuming. In recent years, molecular techniques such as polymerase chain reaction (PCR) are increasingly used to type C. perfringens (Baums et al., 2004). The Present study aimed to determine the prevalence of necrotic enteritis in turkeys, detect some toxin genes and antimicrobial resistance genes in C.perfringens isolated from turkeys (field isolates) using PCR assay and study antimicrobial susceptibility to choice the effective antibiotics against C.perfringens.    

 

MATERIALS AND METHODS

 

Samples:

A total of 200 samples (100 liver and 100 intestine) were collected from 100 turkeys, 4-6weeks age (20 apparently healthy, 40 clinically diseased and 40 freshly dead) were obtained from different turkey farms in Dakahlia province. The samples were collected aseptically in sterile separate labeled bags in an ice box then were transferred without delay to be examined bacteriologically for isolation and identification of the causative microbe.

 

Clinical and Postmortem examination:

All turkeys were examined clinically, then sacrificed and immersed in a disinfectant before being autopsied. Gross pathological changes were recorded, summarized and presented with results for both freshly dead and clinically diseased turkeys.

 

Isolation and identification:

The samples were inoculated into tubes of freshly prepared boiled then rapidly cooled cooked meat medium (CMM) (Oxoid) and incubated anaerobically for 24 hours at 37°C in a Gaspak anaerobic jar (Willis, A.T. ,1977). A loopful of inoculated fluid medium was streaked onto neomycin sulphate (200ug/ml) sheep blood agar plates then re-incubated anaerobically for 24 h at 37°C (Cruickshank et al., 1975). The lecithinase activity of suspected C. perfringens colonies were tested on egg yolk agar medium.Typical colonies (lecithinase producer and showed doublezone of hemolysis on blood agar medium) were picked up,sub-cultured and purified for further biochemicalidentification tests (Koneman et al., 1983).

 

Molecular characterization of C. perfringensby PCR:

Five C.perfringensisolates (field isolates) were subjected to PCR test in PCR unit, Animal Health Research Institute (AHRI), Egypt.

 

DNA extraction from C. perfringensisolates:

Extraction was done by using Patho Gene-Spin TM, DNA/RNA Extraction kit iNtRON cat. No. 17154 Korea according to the instructions of the manufacturer.

 

Oligonucleotide Primer:

The PCR primers used in this study are listed in table (1).

Oligonucleotide primer used in PCR reactions were synthesized by Sigma Company, (Germany). PCR reaction was performed in Gradient Thermal cycler (S 1000 Thermal cycler Bio-RAD USA). The reaction mixture (total volume of 50 µl) was 25 µl M. Mix (Cosmo PCR red Master Mix (2X) Willowfort W1020300x), England), 2 µl target DNA, 1 µl of each primers (containing 10 p mole/ µl) and the mixture was completed by water nuclease free to 50 µl.

 

Analysis of the PCR Products:

Run 5-8μl of the PCR product in parallel with a 100bp ladder molecular weight marker (100bp DNA Ladder: Thermo Scientific Gene Ruler, Cat. No. SM0243 or SM0321 USA) on a 1.5 % agarose gel (Agarose, Sigma, USA) in TBE (Tris Boric EDTA) 1X buffer. Run for 90 min at about 110V on a mini horizontal electrophoresis unit (BIO-RAD, USA). The gel was stained in ethidium bromide for 20-30min. The gel was visualized under UV transilluminator (Spectroylyne Model TR-312 A) under UV light and photographed by Canon digital camera.

 

 

Table 1: Target genes, PCR Primers and Length of amplification products of C. perfringens.

Target gene

Primer sequence  ( 5'-3' )

Reference

Length of amplification products (bp)

Cpa

 

F: GCTAATGTTACTGCCGTTGA

R: CCTCTGATACATCGTGTAAG

 

 

 

Ahsani

et al., 2010

324

Cpb

 

F:GCGAATATGCTGAATCATCTA

R:GCAGGAACATTAGTATATCTTC

196

Etx

 

F: GCGGTGATATCCATCTATTC

R: CCACTTACTTGTCCTACTAAC

655

NetB

F:GCTGGTGCTGGAATAAATGC R:TCGCCATTGAGTAGTTTCCC

Anthony et al., 2010

383

Lin(B)

 

F: CCTACCTATTGTTTGTGGAA

R: ATAACGTTACTCTCCTATTC

Bozdogan et al., 1999

906

Tet(K)

F: TTATGGTGGTTGTAGCTAGAAA

R: AAAGGGTTAGAAACTCTTGAAA

Masco et al., 2006

382

Table 2: PCR cycling conditions for target genes.

 

Target gene

Stage

Temp.(ºC)

Time

No. of cycles

Cpa

Cpb

Etx

Initial denaturation

94

2 min.

1

Denaturation

94

15 sec.

35

Annealing

55

30 sec.

extension

68

1 min.

NetB

Denaturation

94

30 sec

30

Annealing

55

30 sec

extension

72

1 min.

Lin(B) and Tet(K)

Initial denaturation

94

5 min

1

Denaturation

94

45 sec

35

Annealing

54

45 sec

extension

72

1 min

Final extension

72

5 min

1

 


In vitro Antibiotic Susceptibility Test:

Fourty (40) C.perfringensisolates (field isolates) were subjected to antibiotic sensitivity test against 10 commonly used antibiotics in poultry farms. The antimicrobial susceptibility profile Ampicillin, Amoxicillin, Penicillin, Florfenicol, Enrofloxacin, Vancomycin, Bacitracin, Oxytetracyclin, Lincomycin and Clindamycin was tested by disk diffusion methods according to Clinical and Laboratory Standards Institute (CLSI, 2012).

 

 

RESULTS

 

Table 3: Prevalence of C. perfringens in examined samples collected from turkeys.

 

Samples

No. of examined samples

No. of positive samples

%

Apparently healthy birds (20)

Intestine

20

3

15%

Liver

20

0

0%

Clinically diseased birds (40)

Intestine

40

24

60%

Liver

40

14

35%

Freshly dead birds (40)

Intestine

40

26

65%

Liver

40

15

37.5%

Total

200

82

41%

 

Table 4:  Results of multiplex PCR and PCR assay for detection of some C. perfringens toxin and antimicrobial resistance genes.

 

 

       

Isolate

 

Results

                              Toxin genes

Antimicrobial resistance genes

Cpa   

Cpb

Etx

NetB

Tet(K)

Lin(B)

Alpha toxin gene

Beta toxin gene

Epsilon toxin gene

NE toxin B gene

Tetracycline resistance gene K

Lincomycin resistance gene B

1

+

+

-

-

+

-

2

+

-

-

+

+

+

3

+

+

-

+

-

+

4

+

-

-

-

-

+

5

+

-

-

-

+

-

Total

100%

40%

0%

40%

60%

60%

 

Fig. 1: Agarose gel (1.5%) electrophoresis of multiplex PCR products obtained with various C. perfringens toxin genes (Cpa gene (324bp), Cpb gene (196bp) and Etx gene (655bp).        

Lane 1: DNA marker (GeneRuler 100 bp DNA Ladder)

Lane 2: Control Positive (mix of various toxin types).

Lane 3: Control Negative                                                                                   

Lane 4-8: PCR products of toxin genesfrom C. perfringens field isolates.

 

 

Fig. 2: Agarose gel (1.5%) electrophoresis of PCR products showing amplification of 383 bp fragment using NetB gene primer.

Lane 1: DNA marker (Gene Ruler 100 bp DNA Ladder)

Lane 2: Control Positive.

Lane 3: Control Negative

Lane 4-8: PCR products of NetB genefrom C. perfringens field isolates.

 

 

Fig. 3: Agarose gel (1.5%) electrophoresis of PCR products showing amplification of 906 bp fragment using LinB gene primer.

Lane 1: DNA marker (Gene Ruler 100 bp DNA Ladder)

Lane 2: Control Positive.                                                                               

Lane 3: Control Negative                                                                                                                     

Lane 4-8: PCR products of Lin(B) genefrom C. perfringens field isolates.

 

Fig. 4: Agarose gel (1.5%) electrophoresis of PCR products showing amplification of   382 bp fragment using Tet(K) gene primer.

Lane 1: DNA marker (Gene Ruler 100 bp DNA Ladder)

Lane 2: Control Positive.                                                                                     

Lane 8: Control Negative

Lane 3-7: PCR products of Tet(K) genefrom C. perfringens field isolates.

 

Table 5: Antibiotic sensitivity and resistance pattern for (40) C. perfringens field isolates.

 

Antibiotic

No. of tested isolates

Sensitive

Resistant

No.

%

No.

%

Ampicillin

40

34

85

6

15

Amoxicillin

40

34

85

6

15

Penicillin

40

33

82.5

7

17.5

Florfenicol

40

29

72.5

11

27.5

Enrofloxacin

40

27

67.5

13

32.5

Vancomycin

40

26

65

14

35

Bacitracin

40

24

60

16

40

Oxytetracyclin

40

13

32.5

27

67.5

Lincomycin

40

9

22.5

31

77.5

Clindamycin

40

6

15

34

85

 


DISCUSSION

 

Necrotic enteritis in turkeys has emerged in Egypt in the last years as an economic problem causing great losses and great concern for the breeders. The present study was undertaken to study the incidence of the disease, antimicrobial susceptibility and detection of some toxin and antimicrobial resistance genes of C. perfringens field isolates involved in apparently healthy and diseased turkeys.

 

In the present investigation, turkeys from affected flocks with C.perfringens showed clinical signs including a sudden increase in mortality observed in the flock, depression, ruffled feathers, diarrhea, dehydration and emaciation with decrease in feed consumption and sometimes an increase in water consumption. These findings agreed with that observed by Saif et al. (2003). While, postmortem findings were consistent with necrotic enteritis (NE) with the small intestines which most frequently and severely affected. Small and demarcated lesions were found in the duodenal loop, hepatitis and choleocystitis were also observed. Unopened intestines were gas-filled and enlarged and their wall appeared thin. The intestinal contents were dark due to necrotic material. The opened intestines showed necrotic lesions of varying severity of the mucosa. In severe cases, the mucosa was covered with a typically thick greenish or yellowish diphtheric pseudomembrane (“Turkish towel”). These findings agreed with that observed by Lyhs et al. (2013).

 

In general, the investigation of 200 samples collected from apparently healthy, clinically diseased and freshly dead turkeys revealed that, only 82 samples were positive to C. perfringens the prevalence rate   was 41% (Table 3). Nearly similar results were recorded byHeidy et al. (2015)who recorded that the prevalence rate of C. perfringens in turkeys was 45.9%. On the other hand, Gad et al. (2011) and Parvaiz et al. (2017) recorded that the prevalence rates were 29.1% and 31.01%, respectively. These differences may be due to age, immune status of birds, nutrition and management.

 

PCR technology is considered to be a convenient and highly reliable tool for molecular detection of the major toxin genes such as (alpha, beta, epsilon, and iota toxin genes) (Yoo et al., 1997).

 

In the present study, five C. Perfringens isolates (field isolates) were analyzed by multiplex PCR in order to detect the presence of some toxin genes. A mixture of primers of Cpa (alpha toxin) gene (324bp), Cpb (beta toxin) gene (196bp) and etx (epsilon toxin) gene (655bp) were used. Also, these Five C. Perfringens isolates were analyzed by PCR in order to detect the NetB (necrotic enteritis toxin B) gene (383 bp).

 

All toxigenic types of C.perfringens are able to produce alpha toxin which has lecithinase activity and causes tissue necrosis especially in small intestine so alpha toxin is mainly responsible for necrotic enteritis in birdsKeyburn et al. (2010).

 

Our results revealed that the Cpa gene (alpha toxin) was detected in all tested isolates (100%) confirming the isolates as C. perfringens (Table 4 and Figure 1). This was in the same direction with the result of Engstrom et al.  (2003) and Lyhs et al. (2013)who detected Cpa gene (alpha toxin) in alltested isolatesof C. perfringens.

 

Enterotoxins are frequently cytotoxic and kill cells by altering the apical membrane permeability of the mucosal cell of the intestinal wall. They are mostly pore-forming toxins, secreted by bacteria that led to form pores in cell membrane causing cell necrosis (Cooper and Songer, 2009).   

 

With respect to Cpb gene (beta toxin), it was detected in two of the tested isolates (40%)(Table 4 and Figure 1) indicating that Cpb has a role in development of necrotic enteritis. This was agreed with that recorded byAhsani et al. (2010).

 

The Etx gene (epsilon toxin) was not detected in any of the tested isolates (0%) (Table 4 and Figure 1). These results agreed with that reported by Baums et al. 2004.

 

NetB gene (necrotic enteritis toxin B) is located on a plasmid and encodes a pore-forming toxin, which perforates the plasma membrane and thereby damages host cells(Keyburn et al., 2010).

 

In the present investigation, NetB gene was detected in two of the isolates (40%) that were recovered from turkeys with necrotic enteritis (Table 4 and Figure 2). These results were nearly similar with that recorded by Abildgaard et al. (2010) who reported that 52% of the C. perfringens strains isolated from NE-affected birds were netB-positive. Onthe other hand,Keyburn et al. (2010)reported that 70% of the C. perfringens strains isolated from NE-affected birds were netB-positive and Lyhs et al. (2013)reported that only 8% of C. perfringens isolates recovered from turkeys with NE were netB-positive.

 

Antimicrobial susceptibility of 40 C.perfringens isolates recovered from turkeys showed high sensitivity to penicillin group (Ampicillin, Amoxicillin and Penicillin, 85%, 85% and 82.5%, respectively). This was in the same direction with thefindings ofMona and Abdelhafez, (2017). While, C. perfringens isolates showed high resistance to Clindamycin, Lincomycin and Oxytetracyclin (85%, 77.5% and 67.5%, respectively). These results run parallel with that recorded by Martel et al. (2004).

 

 C. perfringens isolates were also screened by PCR assay for the detection of some antibiotic resistance genes, Tetracycline resistance gene, tet(K) (382bp) and Lincomycin resistance gene, lin(B) (906bp). In three of the tested isolates (60%), the tet(K) and lin(B) genes were detected (Table 4 and Figures 3 and 4). These findings support the antimicrobial susceptibility test results. These results were in agreement with Ahmadreza et al. (2009) who detected tet(K) and lin(B) genes in C.perfringens isolates.

 

CONCLUSION

 

The presence of some toxin genes confirmed the pathogenic potential of the isolated C. perfringens strains and their association with clinical manifestations and postmortem findings. Antibiotic sensitivity and resistance pattern showed high antibiotic resistance of C. perfringens isolates which require strict regulations on the use of antibiotics in veterinary therapy to minimize the emergence of resistant bacteria in turkeys which may increase the public health problem.

 

REFERENCES

 

Abildgaard, L.; Sondergaard, T.E.; Engberg, R.M.; Schramm, A. and Højberg, O. (2010): In vitro production of necrotic enteritis toxin B, NetB, by netB-positive and netB-negative Clostridium perfringens originating from healthy and diseased broiler chickens. Vet. Microbiol.  144:231–235.

Ahmadreza Gholamiandehkordi; Venessa Eeckhaut; Anouk Lanckriet; Leen Timbermont; Lotte Bjerrum; Richard Ducatelle; Freddy Haesebrouck and Filip Van Immerseel (2009): Antimicrobial resistance in Clostridium perfringens isolates from poultry in Belgium. Vet Res Commun (2009) 33:1031–1037.

Ahsani, M.R.; Mohammadabadi, M.R. and Shamsaddini, M.B. (2010): Clostridium perfringens isolate typing by multiplex PCR. The Journal of Venomous Animals and Toxins including Tropical Diseases 16(4): 573-578.

Al-Sheikhly, F. and Truscott, R.B. (1977): The interaction of Clostridium perfringens and its toxins in the production of necrotic enteritis of chickens. Avian Dis. 21: 256 – 263.

Anthony, L.K; Xu-Xia, Y.; Trudi, L.B.; Filip, V.I.A.; Julian, I.R and Robert, J.M. (2010): Association between avian necrotic enteritis And Clostridium perfringens strains expressing NetB toxin.

Baums, C.G.; Schotte, U.; Amtsberg, G. and Goethe, R. (2004): Diagnostic multiplex PCR for toxin genotyping of Clostridium perfringens isolates. Veterinary Microbiology, 20, 11–16.

Bozdogan, B.; Berrezouga, L.; Kuo, M.; Yurek, D.A.; Farley, K.A.; Stockman, B.J. and Leclercq, R. (1999): A new resistance gene, linB, conferring resistance to lincosamides by nucleotidylation in Enterococcus faecium HM1025. Antimicrob. Agents Chemother. 43, 925–929.

CLSI (2012): The Clinical and Laboratory Standards Institute: Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard. 9th Edition. M07-A9, 32(2).

Cooper K.K. and Songer J.G. (2009): Necrotic enteritis in birds: A paradigm of enteric infection by Clostridium perfringens type A. Anaerobe 15:55–60.

Cooper, K.K.; Theoret, J.R.; Stewart, B.A.; Trinh, H.T.; Glock, R.D. and Songer, J.G. (2010): Virulence for chickens of Clostridium perfringens isolated from poultry and other sources. Anaerobe 16: 289 – 292.

Cruickshank, R.; Duguid, J.P.; Marmion, B.R. and Swain, R.H.A. (1975): Medical Microbiology, 12th Ed., Living stone, London, New York, 812-825.

Engstrom, B.E.; Fermer, C.; Lindberg, A.; Saarinen, E.; Baverud, V. and Gunnarsson, A. (2003): Molecular typing of isolates of Clostridium perfringens from healthy and diseased poultry. Vet. Microbiol. 94:225–235.

Gad, W.; Hauck, R.; Kruger, M. and Hafez, H.M. (2011): Prevalence of Clostridium Perfringens in commercial turkeys and layer flocks. Arch. Geflugelk., 75(2).S. 74-79.

Hatheway, C.L. (1990): Toxigenic clostridia. Clin. Microbiol. Rev.3: 66–98.).

Heidy Abo Elyazeed; AmanyElsayed; Sherif Marouf and Mohamed Refai (2015): Typing of Clostridium Perfringens isolates recovered from Necrotic Enteritis in Turkeys in Egypt by Multiplex PCR. International Journal of Research Studies in Biosciences (IJRSB) Volume 3, Issue 8, August 2015, PP 1-6.

Keyburn, A.L.; Yan, X.-X.; Bannam, T. L.; Van Immerseel, F.; Rood, J.I. and Moore, R.J. (2010): Association between avian necrotic enteritis and Clostridium perfringens strains expressing NetB toxin.Vet. Res. 41:  21– 28.

Koneman, E.W.; Allen, S.D.; Dowell, V.R. and Summers, H.W. (1983): Color atlas and text book of diagnostic microbiology. 2nd Ed. J. B. LippinCott, New York, London.

Lyhs, U.; Perko-Mäkelä, P.; Kallio, H.; Brockmann, A.; Heinikainen, S.; Tuuri,  H. and Pedersen, K. (2013): Characterization of Clostridium perfringens isolates from healthy turkeys and from turkeys with necrotic enteritis. Poultry Science 92: 1750–1757.

 Manteca, C.; Daube, G; Jauniaux, T.; Linden, A.; Pirson, V.; Detilleux, J.; Ginter, A.; Coppe, P.; Kaeckenbeeck, A. and Mainil, J.G. (2002): A role for the Clostridium perfringens β-2 toxin in bovine enterotoxaemia. Vet. Microbiol.86: 191–202.

Martel, A.; Devriese, L.A.; Cauwerts, K.; De Gussem, K.; Decostere, A. and Haesebrouck, F. (2004): Susceptibility of Clostridium perfringens strains from broiler chickens to antibiotics and anticoccidials. Avian Pathol. 33, 3-7.

Masco, L.; Van Hoorde, K.; De Brandt, E.; Swings, J. and Huys, G. (2006): Antimicrobial susceptibility of Bifidobacterium strains from humans, animals and probiotic products. J. Antimicrob. Chemother. 58, 85–94.

Mona, A.A. Abdel Rahman and Abdelhafez, S. Abdelhafez (2017): Prevalence of Clostridium perfringens isolated from poultry. AHRI, 1st inter. con. Abstracts book, Pp. 36.

Parvaiz, S. Dar; Shakil, A. Wani; Aasim, H. Wani; Hussain, I.; Rafia Maqbool; Muhammad, Y. Ganaie; Zahid, A. Kashoo and Qureshi, S. (2017): Isolation, identification and molecular characterization of Clostridium perfringens from poultry in Kashmir valley, India. Journal of Entomology and Zoology Studies, 5(5): 409-414.

 

Saif, Y.M.; Barnes, H.J.; Glisson, J.R.; Fadly, A.M.; McDougald, L.R. and Swayne, D.E. (2003): Diseases of Poultry (11thed.). Iowa State University Press., Blackwell Publishing Company, London, United Kingdom Pp. 849.

Songer, J.G. and R.R. Meer (1996): Genotyping of Clostridium perfringens by polymerase chain reaction is a useful adjunct to diagnosis of clostridial enteric disease in animals. Anaerobe. , (2): 197-203.

Timbermont, L.; Haesebrouck, F.; Ducatelle, R. and Van Immerseel, F. (2011): Necrotic enteritis in broilers: An updated review on the pathogenesis. Avian Pathol.40: 341– 347.

Willis, A. T. (1977): Anaerobic Bacteriology-Clinical and Laboratory Practice. 3rded.

Yoo, H.S.; Lee, S.U.; Park, K.Y. and Park, Y.H. (1997): Molecular typing and epidemiological survey of prevalence of Clostridium perfringens types by multiplex PCR. J Clin. Microbiol. 1997; 35(1): 228-32.

 

 

 

 

  التوصيف الجزيئي للکلستريديم برفرنجنز المعزوله من دجاج الرومي

 

محمد ابراهيم الجاعوص ،مصطفي ربيع خليل، محمود عبدالنعيم عبد الرحمن ، أحمد حجازي رمضان

E-mail:  elgaos122@gmail.com        Assuit University web-site: www.aun.edu.eg

 

أجريت هذه الدراسه علي عدد 200 عينه من الأعضاء الداخليه (100 من الکبد و 100 من الأمعاء) لعدد 100 دجاجه رومي عمر من 4 الي 6 أسابيع ( 20 سليم ظاهريا ، 40 مصاب ، 40 نافق حديثا) تم تجميعها من مزارع دجاج رومي مختلفه بمحافظه الدقهليه. وباجراء الفحص الظاهري للطيور المصابه ظاهريا تبين وجود خمول ، ضعف عام ، اسهال مع علامات جفاف ، انخفاض معدلات استهلاک العلف مع زيادة استهلاک مياه الشرب وحدوث نفوق مفاجئ وزيادة معدلات النفوق بين القطيع. وباجراء الصفه التشريحيه تبين وجود علامات التهاب الأمعاء التنکرزي خاصة في الأمعاء الدقيقه مع ظهور انتفاخ في الأمعاء مع صغر في سمک جدارها وعند فتحها ظهر محتوي الأمعاء داکن اللون نتيجة وجود الأغشيه المتنکرزه والأنزفه مع الغازات والتهاب الکبد والحوصله المراريه. أظهر الفحص البکتريولوجي أن إجمالى عدد العينات الأيجابيه للکلستريديم برفرنجنز 82 عينه بنسبه عامه 41%. تم اجراء اختبار البلمره المتسلسل المتعدد لعدد 5 معزولات حقلية من الکلستريديم برفرنجنزلتحديد والکشف عن بعض الجينات المسئوله عن افراز السموم. وقد تبين وجود الجين المسئول عن افراز سم الألفا (Cpa gene) في  جميع العينات المفحوصه (100%) وهذا يؤکد أن المعزولات للکلستريديم برفرنجنز. کما تبين وجود الجين المسئول عن إفراز سم البيتا ((Cpb gene بنسبة 40% ولم يتبين وجود جين سم الابسيلون ( (Etx geneفي أي من المعزولات  بينما وجد الجين المسئول عن افراز  NE toxin B ((NetB gene بنسبة 40%. وباجراء اختبار الحساسيه لعدد 40 معزوله من للکلستريديم برفرنجنزلقياس نسبة مقاومتها لعدد 10 مضادات حيويه شائع استخدامها في مزارع دجاج الرومي تبين أن نسبة حساسية المعزولات کانت 85%  لکلا من الأمبسيلين والاموکسيسلين، 82,5% للبنسيلين، 72,5% للفلورفينيکول ، 67,5% للانروفلوکساسين ، 65% للفانکومايسين ، 60% للباستراسين ، 32,5% للأوکسي تتراسيکلين ، 22.5% للينکومايسين و 15% للکلينداميسين. ودعم اجراء اختبار انزيم البلمره المتسلسل لعدد 5 معزولات هذه النتائج بالکشف عن وجود جينات مقاومه للتتراسيکين  gene( Tet(Kبنسبة 60% واللينکومايسين  gene (Lin(B بنسبة 60%. وقد خلصت هذه الدراسة لوجود علاقة بين وجود الجينات المفرزة للسموم وشدة وضراوة الکلستريديم برفرنجنزونظرا لارتفاع نسب مقاومة ميکروب الکلستريديم برفرنجنزلأغلب المضادات الحيويه توصي هذه الدراسه بالحد من استخدام المضادات الحيويه بطرق غير علميه في مزارع دجاج الرومى واجراء الإختبارات المعمليه المناسبه لاختيارالمضادات الحيويه الفعاله لتفادي حدوث مقاومه من الميکروبات لها . 

 

 

REFERENCES
 
Abildgaard, L.; Sondergaard, T.E.; Engberg, R.M.; Schramm, A. and Højberg, O. (2010): In vitro production of necrotic enteritis toxin B, NetB, by netB-positive and netB-negative Clostridium perfringens originating from healthy and diseased broiler chickens. Vet. Microbiol.  144:231–235.
Ahmadreza Gholamiandehkordi; Venessa Eeckhaut; Anouk Lanckriet; Leen Timbermont; Lotte Bjerrum; Richard Ducatelle; Freddy Haesebrouck and Filip Van Immerseel (2009): Antimicrobial resistance in Clostridium perfringens isolates from poultry in Belgium. Vet Res Commun (2009) 33:1031–1037.
Ahsani, M.R.; Mohammadabadi, M.R. and Shamsaddini, M.B. (2010): Clostridium perfringens isolate typing by multiplex PCR. The Journal of Venomous Animals and Toxins including Tropical Diseases 16(4): 573-578.
Al-Sheikhly, F. and Truscott, R.B. (1977): The interaction of Clostridium perfringens and its toxins in the production of necrotic enteritis of chickens. Avian Dis. 21: 256 – 263.
Anthony, L.K; Xu-Xia, Y.; Trudi, L.B.; Filip, V.I.A.; Julian, I.R and Robert, J.M. (2010): Association between avian necrotic enteritis And Clostridium perfringens strains expressing NetB toxin.
Baums, C.G.; Schotte, U.; Amtsberg, G. and Goethe, R. (2004): Diagnostic multiplex PCR for toxin genotyping of Clostridium perfringens isolates. Veterinary Microbiology, 20, 11–16.
Bozdogan, B.; Berrezouga, L.; Kuo, M.; Yurek, D.A.; Farley, K.A.; Stockman, B.J. and Leclercq, R. (1999): A new resistance gene, linB, conferring resistance to lincosamides by nucleotidylation in Enterococcus faecium HM1025. Antimicrob. Agents Chemother. 43, 925–929.
CLSI (2012): The Clinical and Laboratory Standards Institute: Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically; approved standard. 9th Edition. M07-A9, 32(2).
Cooper K.K. and Songer J.G. (2009): Necrotic enteritis in birds: A paradigm of enteric infection by Clostridium perfringens type A. Anaerobe 15:55–60.
Cooper, K.K.; Theoret, J.R.; Stewart, B.A.; Trinh, H.T.; Glock, R.D. and Songer, J.G. (2010): Virulence for chickens of Clostridium perfringens isolated from poultry and other sources. Anaerobe 16: 289 – 292.
Cruickshank, R.; Duguid, J.P.; Marmion, B.R. and Swain, R.H.A. (1975): Medical Microbiology, 12th Ed., Living stone, London, New York, 812-825.
Engstrom, B.E.; Fermer, C.; Lindberg, A.; Saarinen, E.; Baverud, V. and Gunnarsson, A. (2003): Molecular typing of isolates of Clostridium perfringens from healthy and diseased poultry. Vet. Microbiol. 94:225–235.
Gad, W.; Hauck, R.; Kruger, M. and Hafez, H.M. (2011): Prevalence of Clostridium Perfringens in commercial turkeys and layer flocks. Arch. Geflugelk., 75(2).S. 74-79.
Hatheway, C.L. (1990): Toxigenic clostridia. Clin. Microbiol. Rev.3: 66–98.).
Heidy Abo Elyazeed; AmanyElsayed; Sherif Marouf and Mohamed Refai (2015): Typing of Clostridium Perfringens isolates recovered from Necrotic Enteritis in Turkeys in Egypt by Multiplex PCR. International Journal of Research Studies in Biosciences (IJRSB) Volume 3, Issue 8, August 2015, PP 1-6.
Keyburn, A.L.; Yan, X.-X.; Bannam, T. L.; Van Immerseel, F.; Rood, J.I. and Moore, R.J. (2010): Association between avian necrotic enteritis and Clostridium perfringens strains expressing NetB toxin.Vet. Res. 41:  21– 28.
Koneman, E.W.; Allen, S.D.; Dowell, V.R. and Summers, H.W. (1983): Color atlas and text book of diagnostic microbiology. 2nd Ed. J. B. LippinCott, New York, London.
Lyhs, U.; Perko-Mäkelä, P.; Kallio, H.; Brockmann, A.; Heinikainen, S.; Tuuri,  H. and Pedersen, K. (2013): Characterization of Clostridium perfringens isolates from healthy turkeys and from turkeys with necrotic enteritis. Poultry Science 92: 1750–1757.
 Manteca, C.; Daube, G; Jauniaux, T.; Linden, A.; Pirson, V.; Detilleux, J.; Ginter, A.; Coppe, P.; Kaeckenbeeck, A. and Mainil, J.G. (2002): A role for the Clostridium perfringens β-2 toxin in bovine enterotoxaemia. Vet. Microbiol.86: 191–202.
Martel, A.; Devriese, L.A.; Cauwerts, K.; De Gussem, K.; Decostere, A. and Haesebrouck, F. (2004): Susceptibility of Clostridium perfringens strains from broiler chickens to antibiotics and anticoccidials. Avian Pathol. 33, 3-7.
Masco, L.; Van Hoorde, K.; De Brandt, E.; Swings, J. and Huys, G. (2006): Antimicrobial susceptibility of Bifidobacterium strains from humans, animals and probiotic products. J. Antimicrob. Chemother. 58, 85–94.
Mona, A.A. Abdel Rahman and Abdelhafez, S. Abdelhafez (2017): Prevalence of Clostridium perfringens isolated from poultry. AHRI, 1st inter. con. Abstracts book, Pp. 36.
Parvaiz, S. Dar; Shakil, A. Wani; Aasim, H. Wani; Hussain, I.; Rafia Maqbool; Muhammad, Y. Ganaie; Zahid, A. Kashoo and Qureshi, S. (2017): Isolation, identification and molecular characterization of Clostridium perfringens from poultry in Kashmir valley, India. Journal of Entomology and Zoology Studies, 5(5): 409-414.
 
Saif, Y.M.; Barnes, H.J.; Glisson, J.R.; Fadly, A.M.; McDougald, L.R. and Swayne, D.E. (2003): Diseases of Poultry (11thed.). Iowa State University Press., Blackwell Publishing Company, London, United Kingdom Pp. 849.
Songer, J.G. and R.R. Meer (1996): Genotyping of Clostridium perfringens by polymerase chain reaction is a useful adjunct to diagnosis of clostridial enteric disease in animals. Anaerobe. , (2): 197-203.
Timbermont, L.; Haesebrouck, F.; Ducatelle, R. and Van Immerseel, F. (2011): Necrotic enteritis in broilers: An updated review on the pathogenesis. Avian Pathol.40: 341– 347.
Willis, A. T. (1977): Anaerobic Bacteriology-Clinical and Laboratory Practice. 3rded.
Yoo, H.S.; Lee, S.U.; Park, K.Y. and Park, Y.H. (1997): Molecular typing and epidemiological survey of prevalence of Clostridium perfringens types by multiplex PCR. J Clin. Microbiol. 1997; 35(1): 228-32.