MOLECULAR CHARACTERIZATION OF TOXIGENIC AND ANTIBIOTIC RESISTANT OF STAPHYLOCOCCUS AUREUS OF RECURRENT BOVINE MASTITIS

Authors

Department of Mastitis and Neonatal Diseases, Animal Reproduction Research Institute (ARRI), Giza, Egypt

Abstract

To enhance the diagnosis of Staphylococcus aureus mastitis and its prospective antibiotic resistance in dairy cattle, a multiplex polymerase chain reaction (PCR) assay was developed for concurrent species identifycation, detection antibiotic resistant phenotypically and genotypically to penicillin (blaZ gene), gentamycin (aac(6') aph (2'')genes), and tetracycline (tetK, gene) and recognize the toxogenicpatterns of  S. aureus in cow’s milk with recurrent clinical mastitis. Bacterial culturing was carried out on 179 bovine recurrent clinical mastitic milk samples resulted in 84 (46.9%) coagulase positive staph isolates, while 69 (38.5%) confirmed by molecular identification by PCR as S. aureus. Also some virulence factors as enterotoxin A and B (Sea and Seb) genes were determined in 7(10.1%) and 1 (1.4%) respectively in confirmed isolates. As well as determined drugs resistance and their genes. The results of antimicrobial susceptibility tests showed 100%. 43.5% and 58% resistance for penicillin, gentamycin and tetracycline respectively. While genotypically were 100%, 40.6% and 53.6% for (blaZ, aac (6') aph (2'') and tetK, respectively. This study reports the presence of multidrug resistant S. aureusin recurrent clinical mastitis with highly virulent toxic genes that could be a major obstacle in the treatment and control of mastitis in dairy farms causing highly economic impacts and recommended that the polymerase chain reaction (PCR)-based assays to detect pathogens associated with mastitis and that it has several advantages, including rapid results and high sensitivity.

Keywords

Main Subjects


Assiut University web-site: www.aun.edu.eg

 

MOLECULAR CHARACTERIZATION OF TOXIGENICAND ANTIBIOTICRESISTANT OF STAPHYLOCOCCUS AUREUS OF RECURRENT BOVINE MASTITIS

 

EBTSAM E.Z. KOTB; EL-SHAFAIE M.A. and SAMEH A. IBRAHEM

Department of Mastitis and Neonatal Diseases, Animal Reproduction Research

 Institute (ARRI), Giza, Egypt

 

Received: 21 June 2018;     Accepted: 5 July 2018

 

 

ABSTRACT

 

To enhance the diagnosis of Staphylococcus aureus mastitis and its prospective antibiotic resistance in dairy cattle, a multiplex polymerase chain reaction (PCR) assay was developed for concurrent species identifycation, detection antibiotic resistant phenotypically and genotypically to penicillin (blaZ gene), gentamycin (aac(6') aph (2'')genes), and tetracycline (tetK, gene) and recognize the toxogenicpatterns of  S. aureus in cow’s milk with recurrent clinical mastitis. Bacterial culturing was carried out on 179 bovine recurrent clinical mastitic milk samples resulted in 84 (46.9%) coagulase positive staph isolates, while 69 (38.5%) confirmed by molecular identification by PCR as S. aureus. Also some virulence factors as enterotoxin A and B (Sea and Seb) genes were determined in 7(10.1%) and 1 (1.4%) respectively in confirmed isolates. As well as determined drugs resistance and their genes. The results of antimicrobial susceptibility tests showed 100%. 43.5% and 58% resistance for penicillin, gentamycin and tetracycline respectively. While genotypically were 100%, 40.6% and 53.6% for (blaZ, aac (6') aph (2'') and tetK, respectively. This study reports the presence of multidrug resistant S. aureusin recurrent clinical mastitis with highly virulent toxic genes that could be a major obstacle in the treatment and control of mastitis in dairy farms causing highly economic impacts and recommended that the polymerase chain reaction (PCR)-based assays to detect pathogens associated with mastitis and that it has several advantages, including rapid results and high sensitivity.

 

Key words: Mastitis, drug resistance, staph. aureus

 

 


INTRODUCTION

 

In developing countries like Egypt, bovine mastitis consider a major problem in dairy farms and farmers incur heavy economic losses due to expenditures for treatment and reduced milk production Mastitis is a multi-etiological disease, and appropriate control is based on knowledge of the etiology, thus identification of pathogens is a fundamental aspect of mastitis control programs. whatever, Staphylococcal aureus is the most predominant major contagious bacteria studied in dairy farms as they critical source of subclinical and clinical intra-mammary infections rely on the epidemiological studies and mastitis control efforts. Leading to a major problem with zoonotic implications and severe financial losses worldwide (Ebtsam et al., 2014; Pamela, 2014).

 

The pathogenic potential of S. aureus based on numerous  cell  surface  virulence   factors   and   their

 

 

 


Corresponding author: Dr. EL-SHAFAIE M.A.

E-mail address: dr.mohamed_elshafaie@yahoo.com

Present address: Department of Mastitis and Neonatal Diseases, Animal Reproduction Research Institute (ARRI), Giza, Egypt

capability of producing a variety of exotoxins and cell surface-associated proteins that enhance the cellular attachment, invasion to host immune system and stimulation of toxic tissue reactions.

 

(Kalorey et al., 2007; Hussain et al., 2012b). The most identified toxins gene were (sea and seb)from S. aureus isolates from the mastitic milk (Mousa et al., 2017).

 

Improper use of antimicrobials has resulted in augmenting the bacterial resistance mechanisms hinder the treatment and control of S. aureus mastitis as well as intra-mammary infusion for preventive measures in dry cows therapy (David and Daum, 2010).

 

S. aureus strains are capable of mutation, clonal evolution and horizontal gene transfer that boost up the virulence and drug resistance (Brody et al., 2008). Hence, identification of pathogenic and resistant S. aureus from intra mammary infection at herd level is of vital importance for successful treatment and control. Generally changes in mastitis isolate profiles influenced by setting have been reported earlier which again emphasizes the need for periodic evaluation of S. aureus in terms of virulence and antibiotics resistances. Currently, penicillin, gentamycin, erythromycin, and tetracycline are frequently used for the treatment and control of mastitis. Many studies have recommended polymerase chain reaction (PCR)-based assays to detect pathogens associated with mastitis and that it has several advantages, including rapid results and high sensitivity.

 

Therefore, the accurate and rapid diagnosis of genetic variability specially antibiotic resistance genes is necessary to identify the genetic relatedness of strains and their source of spread; and one of the preferred reliable and broad genotyping methodologies is repetitive element  by PCR (Gandhale et al., 2017).

 

Our aim is to investigate the genotypic distribution, enterotoxigenic virulence and resistance patterns of S. aureus strains isolated from mastitic cattle in some Egyptian dairy farms.

 

MATERIALS AND METHODS

 

Bacterial Strains

A total of179 milk samples from recurrent clinical mastitic cows from three dairy farms were collected with briefly history of various animal husbandry practices. After sanitizing, 10ml of Milk was collected in sterile vials, samples were transported at 4˚C and the milk samples were plated onto blood agar, nutrient agar, Baird-Parker agar supplemented with egg-yolk tellurite emulsion and Manitol salt agar (oxid UK) at 37 oC / for 48 hrs. All isolates were confirmed as S. aureus by Gram staining, catalase activity, tube coagulase test In addition to colony morphology and type of hemolysis produced, and then suspected colonies were extra identified by catalase test and tube Coagulase.

 

In udder health and neonates Department Laboratory Animal Reproduction Research institute (ARRI) Egypt, the bacteriological culture and biochemical identification for isolates were done according to National Mastitis Council, (1999).

 

Antimicrobial susceptibility tests:

Antimicrobial susceptibility was tested by Kirby–Bauer disk diffusion method and the minimal inhibition concentrations (MICs) of the antibiotics on Muller-Hinton agar (MHA) according to the Clinical and Laboratory Standards Institute (2014). The investigated antibiotics disks were from (Oxid UK), penicillin G (P, 10 IU), gentamicin (CN, 10 μg), and tetracycline (TE, 30 μg). Pure cultures of S. aureus were grown in brain–heart infusion (BHI) broth and incubated at 37 °C for 18 h. BHI broth cultures were further evenly spread on MHA (Oxid UK) plates. Then inoculated antimicrobial disks were left then at room temperature for 30 min followed by incubation at 37 °C for 24 h to measure the inhibition zone diameters. Strains were classified as resistant, intermediate, or susceptible on the basis of the size of the inhibition zone (in millimeters) and MICs used for interpretation the diameters of the zones of inhibition were as published by Clinical and Laboratory Standards Institute (2014).

 

 

 

Table (1)

 

Antibiotics

zones of inhibition (in millimeters)

Susceptible

Intermediate

Resistance

Penicillin G(10IU)

≥29

21-28

≤20

Tetracycline (30 µg)

≥19

15-18

≤14

Gentamycin(10 µg)

≥15

13-14

≤12

 


DNA Extraction and Detection of Selected Resistance Genes by PCR

Molecular identified of S. aureus and molecular characterization of some virulence and resistance genes as (Sea, Seb, blaZ, tetK and aac (6') aph (2'')), started with extraction of S. aureus DNA  from overnight-grown at 35°C S. aureus cultures in Brain Heart Infusion (BHI) Broth (oxide UK) according to QIAamp DNA mini kit instructions (Catalogue no.51304), then each DNA sample go in PCR with mixing it with PCR mixture according to Emerald Amp GT PCR mastermix (Takara) Code No. RR310A kit. (PCR Master Mix ((Takara) Code No. RR310A), PCR grade water.

 

Oligonucleotide primers with specific sequence gene (Metabion (Germany)) for each virulence character and amplify a specific product as shown in Table (2).

 

 

 


Table (2): Oligonucleotide primers sequences 

 

Gene

Sequence

Amplified product

Reference

16-23s rRNA

Forward: TTCGTACCAGCCAGAGGTGGA

Reverse: TCTTCAGCGCATCACCAATGCC

228 bp

Pradhan et al. (2011)

Sea

GGTTATCAATGTGCGGGTGG

102 bp

Mehrotra et al. (2000)

CGGCACTTTTTTCTCTTCGG

Seb

GTATGGTGGTGTAACTGAGC

164 bp

CCAAATAGTGACGAGTTAGG

blaZ

ACTTCAACACCTGCTGCTTTC

173 bp

Duran et al. (2012)

TGACCACTTTTATCAGCAACC

aac(6')aph (2'')

GAAGTACGCAGAAGAGA

491 bp

ACATGGCAAGCTCTAGGA

tetK

GTAGCGACAATAGGTAATAGT

360 bp

GTAGTGACAATAAACCTCCTA

 

And cycling conditions of the primers during cPCR, temperature and time conditions of the two primers during PCR are shown in Table (3) according to specific authors and Emerald Amp GT PCR mastermix (Takara) kit.

 

Table (3): Cycling conditions of the different primers during cPCR:

 

Gene

Primary denaturation

Secondary denaturation

Annealing

Extension

No. of cycles

Final extension

16-23s rRNA

95ºC/45s

95ºC/45s

1 cycle

95ºC/45s

35 cycles

1 cycle

Sea, Seb,

94˚C

5 min.

94˚C

30 sec.

50˚C

30 sec

72˚C

30 sec

35

72˚C

7 min.

blaZ, tetK, aac(6') aph (2'')

94˚C

5 min.

94˚C

30 sec.

54˚C

45 sec

72˚C

45 sec

35

72˚C

10 min.

 

 

 

The PCR product visualized through running on agarose 1.5% gel electrophoresis containing 0.5 mg ethidium bromide in 0.5× Tris-EDTA electrophoresis buffer) at 100 V and photographed under UV illumination. (Sambrook et al., 1989) with modification and using DNA Molecular weight marker. The ladder was mixed gently by pipetting up and down. 6 μl of the required ladder were directly loaded, the power supply was 1-5 volts/cm of the tank length. The run was stopped after about 30 min and the gel was transferred to UV cabinet, the gel was photographed by a gel documentation system and the data was analyzed through computer software.

 

DISCUSSION

 

Staphylococcus aureus is the most common etiological pathogen of bovine mastitis possessive many virulent factors  and  multidrug resistant make the disease difficult to cure increasing global problem which has become a high  concern for dairy industry worldwide.  So determine the antimicrobial susceptibility profiles is required not only for effective therapy but also for monitoring the spread of resistant strains in defined ecological niches (Hogan and Smith 2003; Coelho et al., 2009). Present study showed that the antimicrobial susceptibility profiles of S. aureus were determined and high levels of resistance to penicillin followed by tetracycline and then gentamycin were detected.

 

The study carried out on 179 recurrent clinically mastitic dairy cows in 3 dairy farms. The bacteriological examination revealed that 8.4% showed no bacterial growth, this result was lower than that recorded by Ebtsam (2001) who recorded that 17.28% of the milk samples had no bacterial growth, also(Ashraf et al., 2017) who reported that no bacterial growth of 30% of collected samples, that indicated the need for another specific pathogen media or spontaneous cure or intermittent shedding of M.O.. While 91.6% of samples showed bacterial growth, out of them 84/179 (46.9%) coagulase Staphylococci (CPS) isolates and 80/179 (44.7%) other isolates.

 

We assayed the genotypes of 84 Coagulase positive Staphstrains isolated from recurrent clinical bovine mastitic milk sampleswhich revealed 69 (38.50%) isolates identified as S. aureus strains by PCR.

 

Present results agree with that previously reported by Bedane et al. (2012) who mentioned that approximately 30%-40% of all mastitis cases caused by S. aureus and nearly to that reported by Mousa et al. (2017) who found the prevalence rate of S. aureus from mastitis was 26.7%. On the other hand, higher prevalence 75% recorded by Jørgensen et al. (2005).

 

Mastitic milk can possess a serious hazard to human consumers due to higher bacterial count or toxins. S. auerus enterotoxins (SE), particular SEA-SEE were the most classical discovered genes in cattle, the isolates showing 8/69 (11.6%) S. aureus enterotoxogenic type A and B gens by PCR as 7/69 (10.1%)and 1/69 (1.5%) were Sea and Seb genes respectively. This result was lower than that was recorded by Yu-Cheng et al. (2008) as they found sea (29.2%) and seb (19.7%), from isolated S. aureus strains and Mousa et al. (2017) recordedenterotoxin sea and seb genes in S. aureus isolates from subclinical mastitis milk were the most prevalent with 60% and (50%), respectively using multiplex PCR.

 

S. aureus antimicrobial resistant strains were determined by disc diffusion assay and the corresponding resistance genes were determined by PCR. The results showed penicillin; gentamycin and tetracycline resistance results were 100%, 43.5% and 58%respectively. These results were different to that recorded by Yang et al. (2016) as antimicrobial resistances of S. aureus were (84.09%, 9.09% and 15.91%) for penicillin, gentamycin and tetracycline respectively.

 

Acquisition of resistance in S. aureus isolates attributed to mutation in gene or due to exchange of genetic material between organisms, since resistance genes carrying mobile genetic elements of S. aureus have exceedingly been explored (Teruyo et al., 2003). The molecular characterization by PCR determination of drug resistance genes (blaZ) for penicillin), genes (aac (6')aph (2'') for aminoglycoside antibiotic as (gentamycin) and gene (tetK) for antibiotic tetracycline were 100%, 40.6% and  53.6 % respectively.

 

The blaZ gene detected in all isolates, these findings are consistent with previous report (Haveri et al., 2007) and agree with the results of Flayhart et al. (2005) who re­ported (97.6%) agreement between different molecu­lar and culture methods. Tetracycline resistance encoding gene tetK was present in 53% of isolates which is lower than previously detected in 96% isolates (Gao et al., 2011).

 

Mechanisms of resistance to antibacterials are so complex that the presence or absence of a certain resistance gene does no certainly indicate that the particular isolate is resistant or sensitive to the corresponding antimicrobial agent (Gow et al., 2008).

 

 

RESULTS

 

Table (4): Bacteriological results of milk samples collected from recurrent clinical mastitis cows.

 

FARMS

recurrent clinical cases

Culturing of milk samples

Coagulase positive Staph (CPS)

CPS with other M.O

All  CPS

other M.O

Neg. Bact.

 

No.

No.

%

No.

%

No.

%

No.

%

No.

%

Farm 1

46

12

26.1%

12

26.1%

24

52.2%

17

37.0%

5

10.8%

Farm 2

55

16

29.1%

10

18.2%

26

47.3%

25

45.5%

4

7.2%

Farm 3

78

18

23.1%

16

20.5%

34

43.6%

38

48.7%

6

7.7%

Total

179

46

25.7%

38

21.2%

84

46.9%

80

44.7%

15

8.4%

 

Allcoagulase positive isolateswere confirmed as S. aureus isolates by PCR using 16s–23s ISR rRNA genes which resulted in 69 (38.5%) isolates of S. aureus.

 

Antibiotic resistance profile of S. aureus

In this study all number of the isolates were resistant to penicillin G 69/69(100%), some were resistant to tetracycline (58%). less resistance was observed in gentamycin (43.3%), (Table5)

Table (5): Drug Resistance

 

Antibiotics

Resistance

Moderate

Sensitive

No

%

No

%

No

%

Penicillin G

69

100

0

0

0

0

Gentamycin

30

43.5

3

4.3

36

52.2

Tetracycline

40

58

6

8.7

23

33.3

 

Table (6): Relationship between the phenotypic and genotypic antibiotics resistance to penicillin, tetracycline, erythromycin and gentamicin in S. aureus

 

 

S. aureus (N=69)

Gene

molecular characterization (PCR)

Phenotypically

(sensitivity test)

 

No.

%

No.

%

(Penicillin) blaZ

69

100

69

100

(Gentamycin)aac(6')aph (2'')

28

40.6

30

43.4

(Tetracycline)tetK

37

53.6

40

58

 

Table (7): S. aureus enterotoxin detection by PCR (N=69).

 

Gene

S. aureus enterotoxin Identification

 

No.

%

enterotoxogenic type A (Sea)

7

10.1

enterotoxogenic type B (Seb)

1

1.4

 

N =(69) equal the total molecular identified of S. aureus isolates

 

     

 

Figure (1): Electrophoresis gel show results of PCR amplification of 16s–23s ISR rRNA gene for detection of S. aureus gene, Lane M: 100 bp DNA ladder, Lane ct. pot.; control positive, Lane ct. Neg.; negative control; Lanes 1-4 and 7: PCR amplified 229 bp product of S. aureus Positive, Lane 5 and 6 are negative.

 


Figure (2): Agarose gel electrophoresis of products on a 2% agarose gel from multiplex PCR of sea, seb gene, Lane M: 100 bp DNA ladder, Lane (Pos.); positive control; Lane (N); negative controls; Lanes (5) PCR amplified 164 bp product of seb gene, Lanes (6) PCR amplified 102 bp product of sea gene Positive, Lane 1, 2, 3 and 4 are negative.

 

 

 

 

Figure (3): Agarose gel electrophoresis of products on a 2% agarose gel from multiplex PCR of (blaZ, tetK, etb and aac (6') aph (2'') gene, Lane M: 100 bp DNA ladder, Lane (Pos.); positive  control; Lane (N); negative controls; Lanes 1, 2, 3, 4, 5 and 6 PCR amplified 173 bp product of blaZ gene PCR amplified 360 bp product of tet gene,  and PCR amplified 226 bp product of etb gene Lanes (6) PCR amplified 491 bp product of aac(6') aph (2'')gene Positive, Lane 1, 2, 3 and 4 are negative.

 

Staphylococci clinical isolates will subjected to antimicrobial susceptibility testing. The genes implicated in resistance to peniillin(blaZ),gentamicin (aac(6’)/aph(2”), and tetracyclin (tetK, tetM). Nizami et al. (2012).

 


CONCLUSION

 

Present study reports increasing prevalence of S. aureus isolates, the frequency of virulence genes and genetic resistance in the isolates is a main reason for treatment failure and possibly leads to spread of resistance in recurrent bovine mastitis in Egypt generally resistant to many of the antimicrobial compounds commonly used for treatment of mastitis, especially penicillin. Therefore Susceptibility testing and PCR are recommended as part of the diagnosis and essential tool for epidemiological studies. These help in selection of the most appropriate designing strategic plans for therapeutic agents for treatment and control spread of S. aureus.

 

REFERENCES

 

Ashraf, A.; Abd El-Tawab, Ashraf, M.; Nabih, Mohsien, A. Agag and Marwah, H., Abd Ali (2017): Molecular studies of virulence genes of salmonella typhimurim causing clinical mastitis in dairy cattle, Benha Veterinary Medical Journal Vol. 33, No 2 : 27 – 37, December  

 Bedane, A.; Kasim, G.; Yohannis, T.; Habtamu, T. and Asseged, B. (2012): Study on Prevalence and Risk Factors of Bovine Mastitis in Borana Pastoral and Agro-Pastoral Settings of Yabello District Borana Zone Southern Ethiopia American-Eurasian. J Agric and Environ Sci 12: 1274-1281.

Brody, T.; Yavatkar, AS.; Lin, Y.; Ross, J.; Kuzin, A.; Kundu, M.; Fann, Y. and Odenwald, WF. (2008): Horizontal gene transfers link a human MRSA pathogen to contagious bovine mastitis bacteria. PLOS ONE, 3: 3074.

Clinical and Laboratory Standards Institute (2014):Clinical andLaboratory Standards Institute Performance standards for antimicrobial susceptibility testing; Twenty-Fourth Informational Supplement. Wayne, PA: Clinical and Laboratory Standards Institute. CLSI document; M100-S24.

Coelho, S.M.O.; Reinoso, E.; Pereira, I.A.; Soares, L.C.; Demo, M.; Bogni, C. and Souza, M. (2009): Virulence factors and antimicrobial resistance of Staphylococcus aureus isolated from bovine mastitis in Rio de Janeiro. Pesquisa Veterinaria Brasileira, 29, 369–374.

David, M.Z. and Daum, R.S. (2010): Community-associated methicillinresistant staphylococcus aureus: epidemiology and clinical consequences of an emerging epidemic. Clin. Microbiol. Rev., 23: 616-687.

Duran, N.; Ozer, B.; Duran, G.G.; Onlen, Y. and Demir, C. (2012):Antibiotic resistance genes & susceptibility patterns in staphylococci. Indian J. Med. Res., 135, pp 389-396.

Ebtsam E.Z. Kotb (2001): Detection of bacterial antigens in milk from clinical cases of bovine mastitis master degree Cairo university.

Ebtsam E.Z. Kotb; Raghib, R.W. and Ola A. Abdelfattah (2014): the economic impact of mastitis in some dairy farms in Egypt. J eypt.Vet. Med. Assoc.4.579-595

Flayhart, D.; Hindler, J.; Bruckner, D.; Hallg, Shrestha, R. and Vogel, SH. (2005): Multicenter evaluation of BBL CHRO Magar MRSA medium for direct detection of methicillin-resistant Staphylococcus aureus from surveillance cultures of the anterior nares. J. Clin Microbiol; 43: 5536-5540.

Gandhale Dattatray; Rahul Kolhe; Saba Nalband; Padmakar Deshpande; Urmila Jagtap; Chandrakant Dhandore; Sujata Bhave; Sameer Jadhav; Dushyant Muglikar and Smita Kolhe (2017): Molecular types and antimicrobial resistance profile of staphylococcus aureus isolated from dairy cows and farm environments, Turkish journal of veterinary and animal sciences 41: 713-724

Gao, J.; Ferreri, M.; Liu, X.Q.; Chen, L.B.; Su, J.L. and Han, B. (2011):Development of multiplex polymerase chain reaction assay for rapid detection of Staphylococcus aureus and selected antibiotic resistance genes in bovine mastitic milk samples. J. Vet. Diagn.  Invest. 23: 894-901.

Gow, S.P.; Waldner, C.L.; Harel, J. and Boerlin, P. (2008): Associations between antimicrobial resistance genes in fecal generic Escherichia coli isolates from cow-calf herds in western Canada. Applied and Environmental Microbiology, 74, 3658–3666.

 Haveri, M.; Roslof, A.; Rantala, L. and Pyorala, S. (2007): Virulence genes of bovine Staphylococcus aureus from persistent and nonpersistent intramammary infections with different clinical characteristics. J. Appl.  Microbiol., 103: 993-1000.

Hogan, J. and Smith, K.L. )2003(: Coliform mastitis. Veterinary Research, 34, 507–519

Hussain, R.; Javed, M.T.; Khan, A.; Mahmood, F. and Kausar, R. (2012b): Mastitis and Associated histo-pathological consequences in the context of udder morphology. Int. J. Agric. Biol., 14: 947-952.

Jørgensen, H.J.; Mork, T.; Caugant, D.A.; Kearns, A. and Rorvik, L.M. (2005): Genetic Variation among Staphylococcus aureus Strains from Norwegian Bulk Milk. Appl. Environ. Microbiol. 71: 8352–8361.

Kalorey, D.R.; Shanmugam, Y.; Kurkure, N.V.; Chousalkar, K.K. and SB. Barbuddhe, S.B. (2007): PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases. J. Vet. Sci., 8: 151-154.

Mehrotra, M.; WANG, G. and Johnson, W.M. (2000): Multiplex PCR for Detection of Genes for Staphylococcus aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin Resistance. JOURNAL OF CLINICAL MICROBIOLOGY. Vol. 38, No. 3.

National Mastitis Council (NMC) (1999): Laboratory handbook on bovine mastitis. Madson: 145-147.

Nizami Duran; Burcin Ozer; Gulay Gulbol Duran; Yusuf Onlen, and Cemil Demir (2012): Antibiotic resistance genes & susceptibility patterns in staphylococci. Indian J. Med. Res. 2012 Mar; 135(3): 389–396.

 Pamela L. Ruegg (2014): http://milkquality.wisc.edu

Pradhan, P.; Gopinath, S.M.; Reddy, G.R.; Dechamma, H.J. and Suryanarayana, V.V.S. (2011): Detection of major pathogens in bovine sub-clinical mastitis by multiplex pcr directly from milk samples in presence of an internal control. Indian Journal of Fundamental and Applied Life Sciences, Vol. 1 (4), pp.209-218.

Sambrook, J.; Fritscgh, E.F. and Mentiates (1989): Molecular coloning. A laboratory  manual. Cold spring Harbor Laboratory press, New York.        

Teruyo, I.; Okuma, K.; Xue, X.; Ma. Yuzawa, H. and Hiramatsu, K. (2003): Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: genomic island SCC. Drug Resist. Update, 6: 41-52.

Yang Feng; Wang, Q.,I.; Wang, X.; Rong, U.; Wang Ling;  Xin-pu1, L.I.; LUO Jin-yin, L.U.O.; Zhang Shi-dong and Hong-sheng, L.I. (2016): Genetic characterization of antimicrobial resistance in Staphylococcus aureus isolated from bovine mastitis cases in Northwest China. Journal of Integrative Agriculture, 15(12): 2842–2847.

Yu-Cheng Chiang, A.; Wan-Wen Liao, A.; Chin-Ming Fan, A.; Wan-Yu Pai, A.; Chien-Shun Chiou, C. and Hau-Yang Tsen (2008): PCR detection of Staphylococcal enterotoxins (SEs) N, O, P, Q, R, U, and survey of SE types in Staphylococcus aureus isolates from food-poisoning cases in Taiwan. International Journal of Food Microbiology 121 (2008) 66–73.

Walid Saad Mousa; Eman abdeen; Heba Hussein and Ghada Hadad (2017): Prevalence and Multiplex PCR for Enterotoxin Genes of Staphylococcus aureus Isolates from Subclinical Mastitis and Kareish Cheese J. Infect. Dis. Preve. Med., 5:4 DOI: 10.4172/2329-8731.1000174, Mousa.

 

 

 

الصفات الجزيئية لسموم المکور العنقودى الذهبى المقاوم لبعض المضادات الحيوية لالتهاب الضرع المتکرر

فى الابقار الحلابة

 

ابتسام السيد زکى قطب ، محمد عبد الظاهر احمد الشافعى ، سامح عبد المجيد ابراهيم

 

E-mail: dr.mohamed_elshafaie@yahoo.com     Assiut University web-site: www.aun.edu.eg

 

هذه الدراسه اجريت على عدد 179 ابقار حلابه من  ثلاث مزارع ابقار تعاني من التهاب الضرع المتکرر. بالفحص البکتيريولوجى التقليدى لعينات الالبان من تلک الابقار الحلابه وجد انه لايوجد نمو بکتيرى فى عدد 15 عينه (8.4 %) ويوجد نمو بکتيرى فى عدد 164 عينه (91.6 %) منهم عدد 84 عينه (46.9%) تم عزل الميکروب العنقودى وعدد 80 عينه (44.7%) ميکروبات اخرى وعن طريق التعريف الجزيئي بواسطة تفاعل البلمره المتسلسل وجد انه 69 عتره من الميکروب العنقودى الذهبى (38.5%)، حيث تم تحديد النمط الظاهري والأنماط الجينية لبعض عوامل الضراوة انتيروتوکسين (A ) و(B ) على التوالى (Sea and Seb) بنسبة (10.1٪ و 1.4٪) على التوالي وکذلک تحديد الجيناتblaZ   و ( aac(6')aph (2'') و tetK المقاومة للمضادات الحيويه البنسللين والجنتاميسين والتتراسيکلين بنسبة 100% و40.6% و53.6 % علي التوالي. أظهر ان تحديد  النمط الجيني بواسطة تفاعل البلمره المتسلسل له دقة اکبر فى الکشف عن توصيف عوامل الضراوه والمقاومة لبعض المضادات الحيويه للميکروبات المستخدمة في علاج التهاب الضرع المتکرر للابقار الحلابه. تشير هذه الدراسة إلى وجود المکورات العنقودية الذهبية التى لها مقدره على فرز الانتيروتوکسين نوعى a , b وکذلک تحمل الصفات الخاصة المقاومة للمضادات الحيويه المتعددة المستخدمه فى علاج التهاب الضرع  المتکرر للابقار الحلابه ومن الممکن أن تشکل عقبة رئيسية في علاج التهاب الضرع في مزارع الألبان وتؤدى الى خسائر لاقتصاديات المزرعه وکذلک امکانية انتقال مثل هذه الميکروبات الى الانسان.

 

 

Ashraf, A.; Abd El-Tawab, Ashraf, M.; Nabih, Mohsien, A. Agag and Marwah, H., Abd Ali (2017): Molecular studies of virulence genes of salmonella typhimurim causing clinical mastitis in dairy cattle, Benha Veterinary Medical Journal Vol. 33, No 2 : 27 – 37, December  
 Bedane, A.; Kasim, G.; Yohannis, T.; Habtamu, T. and Asseged, B. (2012): Study on Prevalence and Risk Factors of Bovine Mastitis in Borana Pastoral and Agro-Pastoral Settings of Yabello District Borana Zone Southern Ethiopia American-Eurasian. J Agric and Environ Sci 12: 1274-1281.
Brody, T.; Yavatkar, AS.; Lin, Y.; Ross, J.; Kuzin, A.; Kundu, M.; Fann, Y. and Odenwald, WF. (2008): Horizontal gene transfers link a human MRSA pathogen to contagious bovine mastitis bacteria. PLOS ONE, 3: 3074.
Clinical and Laboratory Standards Institute (2014):Clinical andLaboratory Standards Institute Performance standards for antimicrobial susceptibility testing; Twenty-Fourth Informational Supplement. Wayne, PA: Clinical and Laboratory Standards Institute. CLSI document; M100-S24.
Coelho, S.M.O.; Reinoso, E.; Pereira, I.A.; Soares, L.C.; Demo, M.; Bogni, C. and Souza, M. (2009): Virulence factors and antimicrobial resistance of Staphylococcus aureus isolated from bovine mastitis in Rio de Janeiro. Pesquisa Veterinaria Brasileira, 29, 369–374.
David, M.Z. and Daum, R.S. (2010): Community-associated methicillinresistant staphylococcus aureus: epidemiology and clinical consequences of an emerging epidemic. Clin. Microbiol. Rev., 23: 616-687.
Duran, N.; Ozer, B.; Duran, G.G.; Onlen, Y. and Demir, C. (2012):Antibiotic resistance genes & susceptibility patterns in staphylococci. Indian J. Med. Res., 135, pp 389-396.
Ebtsam E.Z. Kotb (2001): Detection of bacterial antigens in milk from clinical cases of bovine mastitis master degree Cairo university.
Ebtsam E.Z. Kotb; Raghib, R.W. and Ola A. Abdelfattah (2014): the economic impact of mastitis in some dairy farms in Egypt. J eypt.Vet. Med. Assoc.4.579-595
Flayhart, D.; Hindler, J.; Bruckner, D.; Hallg, Shrestha, R. and Vogel, SH. (2005): Multicenter evaluation of BBL CHRO Magar MRSA medium for direct detection of methicillin-resistant Staphylococcus aureus from surveillance cultures of the anterior nares. J. Clin Microbiol; 43: 5536-5540.
Gandhale Dattatray; Rahul Kolhe; Saba Nalband; Padmakar Deshpande; Urmila Jagtap; Chandrakant Dhandore; Sujata Bhave; Sameer Jadhav; Dushyant Muglikar and Smita Kolhe (2017): Molecular types and antimicrobial resistance profile of staphylococcus aureus isolated from dairy cows and farm environments, Turkish journal of veterinary and animal sciences 41: 713-724
Gao, J.; Ferreri, M.; Liu, X.Q.; Chen, L.B.; Su, J.L. and Han, B. (2011):Development of multiplex polymerase chain reaction assay for rapid detection of Staphylococcus aureus and selected antibiotic resistance genes in bovine mastitic milk samples. J. Vet. Diagn.  Invest. 23: 894-901.
Gow, S.P.; Waldner, C.L.; Harel, J. and Boerlin, P. (2008): Associations between antimicrobial resistance genes in fecal generic Escherichia coli isolates from cow-calf herds in western Canada. Applied and Environmental Microbiology, 74, 3658–3666.
 Haveri, M.; Roslof, A.; Rantala, L. and Pyorala, S. (2007): Virulence genes of bovine Staphylococcus aureus from persistent and nonpersistent intramammary infections with different clinical characteristics. J. Appl.  Microbiol., 103: 993-1000.
Hogan, J. and Smith, K.L. )2003(: Coliform mastitis. Veterinary Research, 34, 507–519
Hussain, R.; Javed, M.T.; Khan, A.; Mahmood, F. and Kausar, R. (2012b): Mastitis and Associated histo-pathological consequences in the context of udder morphology. Int. J. Agric. Biol., 14: 947-952.
Jørgensen, H.J.; Mork, T.; Caugant, D.A.; Kearns, A. and Rorvik, L.M. (2005): Genetic Variation among Staphylococcus aureus Strains from Norwegian Bulk Milk. Appl. Environ. Microbiol. 71: 8352–8361.
Kalorey, D.R.; Shanmugam, Y.; Kurkure, N.V.; Chousalkar, K.K. and SB. Barbuddhe, S.B. (2007): PCR-based detection of genes encoding virulence determinants in Staphylococcus aureus from bovine subclinical mastitis cases. J. Vet. Sci., 8: 151-154.
Mehrotra, M.; WANG, G. and Johnson, W.M. (2000): Multiplex PCR for Detection of Genes for Staphylococcus aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin Resistance. JOURNAL OF CLINICAL MICROBIOLOGY. Vol. 38, No. 3.
National Mastitis Council (NMC) (1999): Laboratory handbook on bovine mastitis. Madson: 145-147.
Nizami Duran; Burcin Ozer; Gulay Gulbol Duran; Yusuf Onlen, and Cemil Demir (2012): Antibiotic resistance genes & susceptibility patterns in staphylococci. Indian J. Med. Res. 2012 Mar; 135(3): 389–396.
 Pamela L. Ruegg (2014): http://milkquality.wisc.edu
Pradhan, P.; Gopinath, S.M.; Reddy, G.R.; Dechamma, H.J. and Suryanarayana, V.V.S. (2011): Detection of major pathogens in bovine sub-clinical mastitis by multiplex pcr directly from milk samples in presence of an internal control. Indian Journal of Fundamental and Applied Life Sciences, Vol. 1 (4), pp.209-218.
Sambrook, J.; Fritscgh, E.F. and Mentiates (1989): Molecular coloning. A laboratory  manual. Cold spring Harbor Laboratory press, New York.        
Teruyo, I.; Okuma, K.; Xue, X.; Ma. Yuzawa, H. and Hiramatsu, K. (2003): Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: genomic island SCC. Drug Resist. Update, 6: 41-52.
Yang Feng; Wang, Q.,I.; Wang, X.; Rong, U.; Wang Ling;  Xin-pu1, L.I.; LUO Jin-yin, L.U.O.; Zhang Shi-dong and Hong-sheng, L.I. (2016): Genetic characterization of antimicrobial resistance in Staphylococcus aureus isolated from bovine mastitis cases in Northwest China. Journal of Integrative Agriculture, 15(12): 2842–2847.
Yu-Cheng Chiang, A.; Wan-Wen Liao, A.; Chin-Ming Fan, A.; Wan-Yu Pai, A.; Chien-Shun Chiou, C. and Hau-Yang Tsen (2008): PCR detection of Staphylococcal enterotoxins (SEs) N, O, P, Q, R, U, and survey of SE types in Staphylococcus aureus isolates from food-poisoning cases in Taiwan. International Journal of Food Microbiology 121 (2008) 66–73.
Walid Saad Mousa; Eman abdeen; Heba Hussein and Ghada Hadad (2017): Prevalence and Multiplex PCR for Enterotoxin Genes of Staphylococcus aureus Isolates from Subclinical Mastitis and Kareish Cheese J. Infect. Dis. Preve. Med., 5:4 DOI: 10.4172/2329-8731.1000174, Mousa.